TRADITIONAL BY BIOCHEMISTRY AND …...of Romania” from Timisoara, 300645, Aradului Street No. 119,...

LUCRĂRI ŞTIINŢIFICE MEDICINĂ VETERINARĂ VOL. XLVIII(1), 2015, TIMIŞOARA

5

TRADITIONAL VERSUS COMMERCIAL YOGURT BY BIOCHEMISTRY AND MOLECULAR BIOLOGY

ANALYTICAL METHODS

MIRELA AHMADI1, OANA-MARIA BOLDURA

1, SORINA POPESCU

2, I. HUTU

1,

C. MIRCU1, CORNELIA MILOVANOV

1, D. DRONCA

3, CAMELIA TULCAN

1

Banat‟s University of Agricultural Sciences and Veterinary Medicine ”King Michael I of Romania” from Timisoara, 300645, Aradului Street No. 119, Timisoara, Romania

1Faculty of Veterinary Medicine

2Faculty of Horticulture and Forestry

3Faculty of Animal Sciences and Biotechnology

E-mail: [email protected]

Summary

We produced in our laboratory yogurt from fresh cow-milk and Vaccinium vitis-idaea (known as lingonberry or cowberry) – freeze, and from “home-made” classic jam

and “home-made” jam with pectin. These yogurt products and another three types or commercial plain yogurt were analyzed. The results presented an improvement of nutritional quality for fruit yogurt compare to plain commercial or home-made yogurt. Also, our study had in view that for yoghurt products the most frequent fraudulent additions reported are soybean protein and maize starch. Those unlabelled addition are difficult to detect by protein based analysis due to manufacture processing. Molecular methods for detection of adulteration in dairy products are based on a specific DNA sequence identification by PCR amplification. If present even in trace quantities, those sequences can be detected by PCR method in any type of product, more or less processed. In this experiment, yoghurt samples were subjected to sequences of soybean and maize DNA identification. Small traces of vegetal DNA were detected in all analyzed samples, but in specific reaction for soybean and maize only the commercial samples were found positive, yet unlabelled accordingly.

Key words: yogurt, Vaccinium vitis-idaea, nutritional facts, PCR

Finding new products with special nutritive properties is concerning the

producers – with their policy market, the consumers – who wants to eat healthy, and of course the scientists – who look for the best solution. Having all these in view, we thought of a natural product with natural ingredients, without any additive for preservation or improving the organoleptic characteristics: a plain yogurt and a yogurt with forest fruits – Vaccinium vitis-idaea (also known as lingonberry, or cowberry).

Yogurt is a very good food product because it is low in saturated fat and cholesterol; is a very good source of protein; and also for lactose (the only carbohydrate from milk); is rich in some vitamins like cobalamin, riboflav in,


6

pantothenic acid; good source for some minerals, like calcium, phosphorus and zinc. If at this product we add fruits, like lingonberry (cowberry).

Vaccinium vitis-idaea has two regional varieties (subspecies) with differences in the leaf size. Thus, Vaccinium vitis-idaea, subsp. minus (Lodd.), known as lingonberry, has smaller leaves (5-18cm) compared to Vaccinium vitis-idaea, subsp. vitis-idaea, known as cowberry, that has bigger leaves (10-30cm). However, both subspecies have very good nutritional characteristics,

being good sources of vitamins: ascorbic acid, retinols and -carotene, thiamine, riboflavin and nicotinic acid; rich in minerals: potassium, calcium, magnesium, phosphorus; very good source of phytochemicals: serotonin and melatonin; are low in proteins and lipids; and the fruit seeds are very good

sources of 3-fatty acids (2, 8, 11). These fruits are also used in traditional medicine for their qualities as antihemorragic, antiseptic, diuretic, astringent, depurative, regulates the nitrogen metabolism, are used for urogenital infectious and gastrointestinal disorders, capillary strengthening, rheumatism, diabetes mellitus, and tonic for nervous system (3, 7, 9, 10, 15, 17).

We have to point the varieties of Vaccinium, because not all are related in composition of nutrients! Thus, the Vaccinium vitis-idaea, subsp. minus (Lodd.), known as lingonberry is related in nutritional facts with Vaccinium vitis-idaea, subsp. vitis-idaea, known as cowberry, but Vaccinium microcarpon, known as European cranberry is not related in nutritional properties with the first two presented.

The authenticity of dairy products is becoming an important issue, being subjected to the attention of producers, scientists and especially of consumers. Among many others, some of the components that are not allowed in milk and milk products are the substitute fat proteins, admixtures of milk of different species, low-cost dairy products but more over the mislabeling of products. A large number of analytical methods to detect frauds have been developed, and continually reassessed to counterattack the manufacturers who pursue these illegal activities. Consecrated procedures to assess the authenticity of dairy products include chromatographic, electrophoresis, and immunoenzymatic methods. New approaches, such as capillary electrophoresis, polymerase chain reaction, and isotope ratio mass spectrometry begin to be widely and successfully used alongside with the former procedures (6). Among the dairy products, the adulteration of yoghurt has become a hot issue. Yoghurt has been found to be adulterated with non-milk proteins, including vegetable protein powder, edible gelatin, and even industrial gelatin (13). Also, modified corn starch is often added to yogurts to improve texture in terms of viscosity and syneresis (18). Addition of starch, a low cost polysaccharide added to milk – prior to heat treatment and acidification/fermentation – modifies the properties of the acid gels (16). This is widely used as additive in the food industry for this purpose. It also helps to keep the fruit uniformity mixed in the yoghurt where applicable (1).


7

Obviously, the analysis methods must evolve otherwise, the adulterations would be out of control and the analysis would be trapped in a cycle of “adulteration, targeted analysis, and new adulterations,” and so on. Therefore, untargeted detection methods are required to enable the screening of dairy products for a range of known and unknown adulterants (6, 12). Recently, PCR-based methods were designed and applied to dairy products in order to authenticate them, and these methods can detect very small amounts of adulterants even in highly processed products.

Materials and methods

We did different fruit yogurts, where we used fresh cow milk and three forms of forest fruits: freeze fruits; fruits from “home-made” classic jam; and fruits from “home-made” jam with pectin; and also we bought from supermarket three different plain yogurts. For every type of yogurt we used in analysis two samples for assuring precise analytical results.

Our study was based on seven different samples (doubled): sample 1 and 2 were plain yogurt home-made from pasteurized cow milk, using as a starter Streptococcus thermophilus, Lactobacillus delbrueckii subsp. bulgaricus (from a commercial product added as 7% for home-made plain yogurt); sample 3 and 4 were yogurt home-made from pasteurized cow milk added with freeze lingonberry (10%); sample 5 and 6 were yogurt home-made from pasteurized cow milk added with classic lingonberry jam (10% jam); sample 7 and 8 were yogurt home-made from pasteurized cow milk added with lingonberry jam with pectin (10% jam); sample 9 and 10 were commercial plain yogurt A (2.8% fat); sample 11 and 12 were commercial plain yogurt B (2.8% fat) and sample 13 and 14 were commercial plain yogurt C (2.8% fat).

The difference between classical lingonberry jam and lingonberry jam with pectin was the time of preparation and the temperature used for preparation. Thus, for classical jam we heat to boil the fruits with sugar for a long time, until the composition of jam has good and acceptable texture, which leads to darkening jam (compared to the color of fruits). However, the jam with pectin needs a much shorter time for preparation and a lower temperature that leads to a very nice texture and color (close to fresh fruits color), and also some of the nutritive components are protected by heat degradation.

From these samples we applied different biochemical analysis (lipid content with butirometric method, ascorbic acid content – with 2,6-dichlorphenilindophenol method, acidity by titration method; and also we try to detect some possible adulteration by PCR method, especially to the samples of commercial yogurt.

After we prepared the samples of yogurt we started the biochemical analytical determination of total lipids and ascorbic acid content. The samples with fruits added, we mixed them with the blander for 2 minutes just to assure a


8

very good homogenization of the product, and this also aerate the product; and after we started the molecular biology analytic method of PCR.

Polymerase Chain Reaction – Controls Samples of raw meat from different species of land animal origin were

used as controls for animal species identification. Certified reference materials (CRM) - Roundup Ready™ soybean and Mon 810 maize produced by the The Institute for Reference Materials and Measurements (IRMM) were used as controls for vegetal DNA.

DNA extraction Genomic DNA was extracted from each sample using the CTAB

method. 100mg dried ground material was mixed with 300μl sterile distillated water. 700μl CTAB buffer (CTAB -20g/l; NaCl- 1.4M; Tris-HCl – 0.1M; Na2EDTA- 20mM, pH 8) was added together with 20μl RNase solution (10mg/ml) and the mixture was incubated at 65°C for 30min. The samples were centrifuged at 12,000×g for 10min and the supernatant was transferred to a tube with 500μl chloroform, vortexes and centrifuged at 12,000×g for 15min. The upper layer was transferred to a new tube and 2 volumes of CTAB precipitation solution (CTAB – 5g/l; NaCl – 0.04M) were added. The samples were incubated at room temperature for 60min and centrifuged at 12,000×g for 5min. The pellet was dissolved in 350μl NaCl 1.2M and 350μl chloroform was added. The samples were mixed by vortex and centrifuged at 12,000×g for 10min. The upper layer was precipitated with 0.6 volumes of isopropanol, incubated at room temperature for 20min and centrifuged at 12,000×g for 10min. The pellet was washed in 70% ethanol, vacuum dried and re-suspended in 50μl sterile ultrapure water. Primers used in this study

Amplifiable quality of DNA was confirmed by PCR technique, using ruminant specific primers. The primers were designed in the mitochondrial region 16SRNA and they generated amplification sequences of 104bp length. The specific ruminant primers had the following sequences: F-5‟GAA AGGACAAGAGAAATA AGG 3‟, R-5‟TAGGCCCTTTTCTAGGGCA3‟ (5).

The presence of plant DNA in the samples was assessed by PCR, targeting the chloroplast gene RuBiSco, specific to vegetal genome, with the primers proposed by Rudi et al: CW:5CGTAGCTTCCGGTGGTATCCACGT3', and CX: 5'GGGGCAGGTAAGAAAGGGTTTCGTA3' expected to generate an amplicon of 150bp (14).

For soybean detection the primers were designed for the lectin gene, with the following sequences: GMO3: 5‟GCCCTCTACTCCACCCCCATCC3‟ and GMO4: 5‟GCCCATCTGCAA GCCTTTTTGTG3‟ and the amplified fragment was 118bp.

For detection of maize, the zein gene specific primers were used, with the following sequences 5‟ZEIN3: AGTGCGACCCATATTCCAG3‟ and ZEIN4:


9

5‟GACATTGTGGCATCATCATT3‟. The expected fragment length is about 277bp (ISO 21569:2005). DNA amplification

The final volume for the four PCR reactions was 25μl using Go Taq Green Master Mix PCR kit from Promega according to producer instructions, 20pmol of primers and 50ng/µl DNA template and were performed on a Mastercycler ProS (Eppendorf U.S.) thermalcycler.

The amplification program for ruminant specific primers follows the steps: denaturation 94ºC, 10min, 35 cycles: denaturation 94ºC, 30sec, primer annealing 60ºC, 1min, DNA synthesis 72ºC, 1min and the final extension 72ºC, 5min. For RuBiSco primers the PCR program consisted of an initial denaturing step for 3min at 95°C, followed by 30 cycles of denaturation at 95°C for 20sec, annealing at 63°C for 45sec and extension at 72°C for 1min, with a final step at 72°C for 3min. The PCR program for lectin primers was: denaturation 95°C – 3min; 40 cycles: denaturation 95°C -25sec; primer annealing 62°C – 30sec, DNA synthesis 72°C - 45sec; final extension 72°C – 7min and for the zein primers: denaturation 95°C – 3min; 40 cycles: denaturation 95°C -30sec; primer annealing 60°C – 30sec, DNA synthesis 72°C – 30sec; final extension 72°C – 3min.

The resulting PCR products were separated on 2% agarose gels in TAE buffer at room temperature at a constant voltage of 100V for 40minutes. The PCR products were visualized and photographed under UV light (PhotoDocumentation System, UVP, England).

Results and discussions

Physicochemical analysis of our study yogurt samples presented low

variation of total lipid content of our samples compared to commercial samples. Thus, the first two samples of home-made plain yogurt had 3.6% fat (g lipids / 100g yogurt); the samples 3 and 4 of yogurt with freeze lingonberry contained 3.1% fat (g lipids / 100g fruit yogurt); samples 5, 6, 7, 8 of yogurt with lingonberry

jam contained 3.2% fat (g lipids / 100g fruit yogurt); samples 9 and 10 of commercial yogurt A contained 2.8% fat (g lipids / 100g yogurt); samples 11 and 12 of commercial yogurt B contained 2.6% fat (g lipids / 100g yogurt) and samples 13 and 14 of commercial yogurt C contained 2.7%% fat (g lipids / 100g yogurt). The acidity (pH) of plain yogurt varies a little between 4.0 and 4.5; while the acidity for fruits yogurt varies between 3.7 and 3.8, because of the fruits and jam (with sugar added) acidity characteristics. Also, the mean content of ascorbic acid was 0.8mg/100g yogurt for first two samples (plain home-made yogurt); 1.6mg/100g fruit yogurt for samples 3 and 4 (home-made yogurt with freeze fruits); 1.5mg/100g fruit yogurt for samples 5 and 6 (home-made yogurt with classic jam fruits); 1.8mg/100g fruit yogurt for samples 7 and 8 (home-


10

made yogurt with fruits jam with pectin); and between 0.2 and 0.3mg/100g plain commercial yogurt – samples 9, 10, 11, 12, 13, and 14.

The second part of this study was based on molecular biology analysis of PCR. The investigations started with the yoghurt homogenization followed by the DNA extraction. The DNA samples were analyzed with the specific primers for ruminant specie in order to confirm the ruminant provenience of dairy product and also to confirm that the extracted DNA has amplifiable quality. For avoiding results error every sample was run in duplicate. After the target sequence amplification the PCR products were separated through agarose gel electrophoresis (Fig. 1). The presence of a 350bp amplicon is suggesting the ruminant provenience of the biological sample.

Fig. 1. PCR confirmation of yoghurt origin by detecting ruminant specific sequences: 1, 2: sample 1; 3, 4: sample 2; 5, 6: sample 3; 7, 8: sample 4; 9,10:

sample 5; 11, 12: sample 6; 13, 14: sample 7; 15: positive control, DNA of ruminant origin; 16, reagents control; M: DNA ladder, Express DNA Ladder

(Fermentas)

The presence of vegetal DNA in analysed samples was confirmed by PCR amplification, targeting chloroplastic DNA sequences (Fig. 2). All the samples were positive for ribulose-bisphosphate carboxylase-1.5 (RuBisCo) gene. The detection of this DNA sequence is a proof of vegetal material addition in yoghurt. However since all the samples were found to be positive for vegetal material it is obvious that by this method small trace of DNA becoming from ingested feed can be detected.

Since the vegetal DNA was precisely detected in all samples, the next PCR analyses meant to identify whether the main non-milk component – soybean specific DNA sequence, is present and detectable (Figure 3).

As expected the samples of homemade yoghurt were found to be free of soybean material. The presence of a 118bp amplicon proves that vegetal protein was added probably in large amounts in commercial samples.


11

Fig. 2. PCR confirmation of the vegetal DNA presence in yoghurt samples by detecting ruminant specific sequences: 1, 2 : sample 1; 3, 4: sample 2; 5, 6:

sample 3; 7, 8: sample 4; 9,10: sample 5; 11, 12: sample 6; 13, 14: sample 7; 15: positive control, DNA of vegetal origin; 16. Reagents control; M: DNA

ladder, Express DNA Ladder (Fermentas).

Fig. 3. PCR confirmation of soybean DNA presence in yoghurt samples by detecting ruminant specific sequences: 1, 2 : sample 1; 3, 4: sample 2; 5, 6:

sample 3; 7, 8: sample 4; 9,10: sample 5; 11, 12: sample 6; 13, 14: sample 7; 15: positive control, Soybean DNA; 16, reagents control; M: DNA ladder,

Express DNA Ladder (Fermentas). Considering that the main source of starch food additive is maize,

further on, the amplification with the primers specific for this specie were ran (Fig. 4).

Analyzing the gel it turned out that such in case of soybean, the homemade prepared samples were negative for the presence of maize starch. However, all of the commercial samples contained maize starch, as proved by the presence of specific amplification product.


12

Fig. 4. PCR confirmation of maize DNA presence in yoghurt samples by detecting ruminant specific sequences: 1, 2 : sample 1; 3, 4: sample 2; 5, 6:

sample 3; 7, 8: sample 4; 9,10: sample 5; 11, 12: sample 6; 13, 14: sample 7; 15: positive control, maize DNA; 16, reagents control; M: DNA ladder, Express

DNA Ladder (Fermentas).

Conclusions Plain yogurt and fruit yogurt are food products with high nutritive

properties. Vaccinium vitis-idaea, also known as lingonberry – a forest fruit found

at mountains in Romania, is used in traditional medicine for its high nutritional facts. Home-made yogurt is more appreciate by consumers compared to commercial yogurt because has no additive added.

Our researches demonstrated that the analyzed samples presented low fat content for our home-made plain and fruit (lingonberry) yogurt, that varied between 3.6% (plain yogurt) and 3.1% (freeze lingonberry yogurt), compared to 2.6-2.8% fat content for commercial plain yogurt.

Also, the yogurt samples prepared in the laboratory presented 3.7-3.8 acidity for fruit lingonberry yogurt, compared to 4.0-4.5 acidity for plain yogurt.

The content of ascorbic acid was very low for commercial yogurt (0.2-0.3mg/100g), was also low for plain home-made yogurt (0.8mg/100g), compared to lingonberry yogurt (1.6-1.8mg/100g). This demonstrates that even consumption of lingonberry home-made yogurt can be used as functional food, with enhanced nutritional properties.

All the samples were positive for ribulose-bisphosphate carboxylase-1.5 (RuBisCo) gene, and confirmed the presence of vegetal DNA followed to the vegetal addition, but it is obvious that by this method small traces of DNA can becoming also from ingested feed can be detected. Also, the presence of a 350bp amplicon is suggesting the ruminant provenience of the biological sample.

The samples of homemade yoghurt (plain and with lingonberry) were found to be free of soybean material, while the presence of a 118bp amplicon can a prove of added vegetal protein in commercial samples.


13

As well, the home-made prepared yogurt samples were negative for the presence of maize starch, but all of the commercial yogurt samples contained maize starch, as proved by the presence of specific amplification product.

References

1. Basim, A., Hazim, M., Ammar, E., Rheology of starch–milk–sugar

systems: effect of starch concentration, sugar type and milk fat content, Journal of Food Engineering, 2004, 64, 207-212.

2. Brown, P.N., Turi, C.E., Shipley, P.R., Murch, S.J., Comparisons of large (Vaccinium macrocarpon Ait.) and small (Vaccinium Oxycoccos L., Vaccinium vitis-idaea L.) cranberry in British Columbia by phytochemical determination, antioxidant potential, and metabolomic profiling with chemometric analysis, Planta Med., 2012, Apr., 78(6), 630-40, doi: 10.1055/s-0031-1298239, Epub. 2012 febr 15.

3. Caljouw, M.A., van den Hout, W.B., Putter, H., Achterberg, W.P., Cools, H.J., Gussekloo, J., Effectiveness of crawberyy capsules to prevent urinary tract infections in vulnerable older persons: a double-blind randomized placebo-controlled trial in long-term care facilities, J.Am.Geriatr.Soc., 2014, Jan., 62(1), 103-10.

4. Corpas, Laura, Velciov, Ariana-Bianca, Riviş, A., Olariu, Lucia, Gravila, Corina, Ahmadi Mirela – Physico-chemical characterization of some fruits juices from Romanian Hypermarket, The 2nd International Conference of Food Chemistry, Engineering and Technology, 19-20 May 2011, Timişoara, P14, Journal of Agroalimentary Processes and Technologies.

5. Dalmasso, A., Fontanella, E., Piatti, P., Civera, T., Rosati S., Bottero, M.T., A multiplex PCR assay for the identification of animal species in feedstuffs, Molecular and Cellular Probes, 2004, 18, 81–87. doi:10.1155/2013/201873.

6. De La Fuente, M. A., Manuela, Juárez, Authenticity Assessment of Dairy Products, Critical Reviews in Food Science and Nutrition, 2005, 45, (7-8), DOI:10.1080/10408690490478127.

7. Felicoano, R.P., Krueger, C.G., Reed, J.D., Methods to determine effects of cranberry proanthocyanidins on extra-intestinal infections: relevance for urinary tract health, Mol. Nutr. Food Res., 2015, Apr 27, doi: 10.1002/mnfr.201500108. (Epub. Ahead of print)

8. Howell, A.B., Bioactive compounds in cranberries and their role in prevention of urinary tract infections, Mol. Nutr. Food Res., 2007, Jun., 51(6), 732-7

9. Jungmin, L., Chad, E.F., Lingonberry (Vaccinium vitis-idaea L.) grown in the Pacific Northwest of North America: anthocyanin and free amino acid composition, J. Functional Food, 2012, 4(1), 213-218

http://www.tandfonline.com/loi/bfsn20?open=45#vol_45

http://www.tandfonline.com/toc/bfsn20/45/7-8


14

10. Krueger, C.G., Reed, J.D., Feliciano, R.P., Howell, A.B., Quantifying and characterizing proanthocyanidins in cranberries in relation to urinary tract helath, Anal. Bioanal. Chem., 2013, May, 405(13), 4385-95. doi: 10.1007/s00216-013-6750-3. Epub 2013 Febr 9

11. Kylli, P., Nohynek, L., Puupponen-Pimiä, R., Westerlund-Wikström, B., Leppänen, T., Welling, J., Moilanen, E., Heinonen, M., Lingoberry (Vaccinium vitis-idaea) and European cranberry (Vaccinium microcarpon) proanthocyanidis: isolation, identification, and bioactivities, J. Agric. Food Chem., 2011, Apr., 13, 59(7), 3373-84, doi: 10.1021/jfl04621e. Epub. 2011 Mar 3.

12. Lu, X., Si-Min,Y., Chen-Bo, C., Zhen-Ji, W., Xiao-Ping, Y., The Feasibility of Using Near-Infrared Spectroscopy and Chemometrics for Untargeted Detection of Protein Adulteration in Yogurt: Removing Unwanted Variations in Pure Yogurt, Journal of Analytical Methods in Chemistry, 2013, Article ID 201873.

13. Poppe, J., Gelatin. Thickening and gelling agents for food, Springer US, 1997, 144-168.

14. Rudi, K., Skulberg, O.M., and Jakobsen, K.S., Evolution of cyanobacteria by exchange of genetic material among phyletically related strains. Journal of Bacteriology, 1998. 180: 3453–3461.

15. Sánchez-Patán, F., Barroso, E., van de Wiele, T., Jiménez-Girón A., Martín-Alvarez, P.J., Moreno-Arribas, M.V., Martinez-Cuesta, M.C., Peláez, C., Requena, T., Bartolomé, B., Comparative in vitro fermentations of cranberry and grape seed polyphenols with colonic microbiota, Food Chem., 2015, Sep. 15, 183, 273-82. doi: 10.1016/j.foodchem.2015.03.061. Epub 2015

16. Soukoulis, C., Panagiotidis, P., Koureli, R., & Tzia, C., Industrial yogurt manufacture: Monitoring of fermentation process and improvement of final product quality, Journal of Dairy Science, 2007, 90(6), 2641−2654.

17. Turi, C.E., Finley, J., Shipley, P.R., Murch, S.J., Brown, P.N., Metabolomics for phytochemical discovery: development of statistical approaches using a cranberry model system, J. Nat.Prod., 2015, Apr.24, 78(4), 953-66. doi:10.1021/np500667z. Epub 2015 Mar 9.

18. White P, Yao N., Yogurt and cottage cheese enhanced with nutritionally beneficial oat fiber. Midwest Dairy Foods Research Center Annual Report, 2007, 204-208.


15

BREEDING AND EXPLOITATION OF BOARS ON COMMERCIAL FARM

J. BOJKOVSKI

1, M. MALETIŠ

1, S. VAKANJAC

1, N. ZDRAVKOVIŠ

1, A. VASIŠ

1,

J. MALETIŠ1, I. APIŠ

3, T. VASILJEVIŠ

3, N. DELIŠ

4

1University of Belgrade, Faculty of Veterinary Medicine, Bulevar Oslobodjenja 18,

Belgrade, Serbia 2Veterinarski zavod Subotica, Subotica, Serbia

2 Patent-Co, Belgrade, Serbia

4Institute for Animal Husbandry, Belgrade, Serbia


Breeding and exploitation of boars on commercial farms aimed at producing sperm doses for personal use. The lifetime of boars and therefore the length of their exploitation largely depend on their health. Therefore, control of the health status of the boars, quality control sperm for artificial insemination by overseeing the entire process of taking to sperm quality insemination dose optimization and comprehensive environmental conditions hold (accommodation, microclimate, food, power, attitude of employees), represent important parameters in terms of health control themselves boars, health control of the entire herd or economic parameters and productivity of farms and the profitability of the entire production. On a commercial farm at a total of 28 boar, race Landrace and Jokshir who were in exploitation during one calendar year following parameters: the number of inseminated gilts, sows number insemintion , repeated heats, the number of pollinated piglets, number of live births, and the number of stillborn piglets. Of all the 28 boars that were in exploitation were took blood. Sera boars we used to study prervalence porcine circovirus antibodies to type 2 (PCV2) using the ELISA test. We found that out of 28 tested samples was positive 21 samples. We have established the prevalence of antibodies to porcine circovirus type 2 PCV2 in tested boars.

Key words: boars, holding, exploitation, PCV2, comercial farm

Boars use on commercial farms aims for dwindle costs through producing

sperm doses for internal use, and in hand mating if needed. Health control measures for pigs are partly regulated by legislative acts, which are mandatory, and other measures are recommended and depend on farm health policy. Diseases that can be transmitted by sperm to inseminated sows and gilts jeopardize their health and cause economic damage to the farm. In order to minimize secondary expanses in pig production there are several worldwide recommendations for disease prevention and control (where particular infective agent threatens). Those are: vaccination against swine Fever, Erysipelas, and Parvovirus (PPV) twice a year, serological surveillance tests annually for Brucellosis, Leptspirsis, PRRS, Aujeszky's disease, Swine Transmissible Gastroenteritis (TGE), Listeriosis, Atrophic Rhinitis, Inclusion Rhinitis and Parvoviroses. Introduced boars should be annually tested for tuberculosis and Jhone‟s disease. In the other hand, we can not ignore the possible presence of


16

bacteria in seeds boars: Staphylococcus spp, Corynebacterium spp, Pseudomonas spp, Streptococcus spp, Escherichia spp, Proteus spp, Klebsiella spp, Serratia spp, Citrobacter spp, Bacillus spp, Micrococcus spp, Enterobacter spp, Eubacterium spp. Aerobacter spp, Bordetella spp, Mycoplasma spp, Brucella suis, Actinobacillus, Pasteurella, Salmonella spp., Campylobacter sp. and the possible presence of the following highly infective viruses and contaminating viruses that are transmitted by seed: Pseudorabies, PRRS, Porcine Parvo Virus, African Swine Fever, Adenovirus, Cytomegalovirus, Enterovirus, Foot and Mouth Disease, Hog Cholera, Japanese Encephalitis, Reovirus, Swine Influenza, Swine Vesicular Disease, Transmissible Genital Papilloma (24). The possibility of the spread of infectious agents was significantly reduced by introducing technology of artificial insemination, bacteriological examination of native sperm, prepuce swabs and smears and environment in which boar resides (under the pen walls, feeders, drinkers). Health control of breeding boars and contribute to the improvement of reproductive parameters in commercial farms. Porcine circovirus type 2 (PCV-2) is the major causative agent of postweaning multisystemic wasting syndrome (PMWS) and is associated with different syndromes that affect the swine. The term PCVAD (Porcine circovirus associated diseases) was introduced in 2006 to gather many diseases. Porcine circovirus (PCV) is a DNA, non-enveloped, virus that contains a singlestranded, circular genome and belongs to the family Circoviridae, genus Circovirus. PCV was first identified in 1974 as a contaminant of the continuous porcine kidney cell line PK-15 (25) and later found to be non-pathogenic based on experimental inoculation of pigs (26). A wasting disease in pigs known as post-weaning multisystemic wasting syndrome (PMWS) was first observed in 1991 in western Canada and later associated with a PCV found to be distinct from the nonpathogenic PCV according to nucleotide sequencing (1, 2). To differentiate between the two PCV variants, it was decided to use the terminology PCV1 to indicate non-pathogenic isolates and PCV2 to indicate isolates associated with disease and PMWS (10). Later, PCV2 was also found to be associated with respiratory disease, enteritis, reproductive failure, and porcine dermatitis and nephropathy syndrome (PDNS), which are now collectively known as porcine circovirus associated disease (PCVAD). Retrospectively, PCV2 has been detected in archived tissues collected as early as 1962 in Germany (12) and is now found globally. PCV2 has proven to be ubiquitous in nature, causing disease in varying percentages of animals within a group while the rest of the herd typically does not display clinical signs (5). PCV2 can be further subdivided into subtypes 2a through 2e (28) (13). The hallmark lesion associated with PCV2 infection is lymphadenopathy, or enlargement of most lymph nodes, which correlates with lymphoid depletion at the cellular level.

The exact mechanism of PCV2-associated lymphoid depletion is still unknown and there have been contradicting results. In a conventional pig model, the authors demonstrated the presence of PCV2 antigen within apoptotic lymphocytes using PCV2 specific immunohistochemistry (IHC) and terminal


17

transferase dUTP nick end labeling. The hallmark lesion associated with PCV2 infection is lymphadenopathy, or enlargement of most lymph nodes, which correlates with lymphoid depletion at the cellular level (23). Apoptosis is a programmed mechanism which keeps a balance between cell proliferation and cell death. Presence of PCV2 DNA was demonstrated in hepatocytes of clinically affected pigs (17) and in a follow-up study, 88% of the livers from pigs suffering of naturally occurring PMWS contained apoptotic hepatocytes with apoptotic bodies (18). However, contradicting results were obtained by another research group in 2004 who investigated 21 pigs categorized in three lesional severity stages and five healthy control pigs (19). Apoptotic rates in lymphoid tissues were correlated inversely with viral load in serum and with severity of lesions (19). A study conducted in gnotobiotic pigs was unable to associate PCV2 with apoptosis in hepatocytes and concluded that apoptosis was not the chief pathway for hepatocytic cell loss (14). PCV2b was associated with enhancement of PCVAD in field conditions.

There are two main methods to demonstrate apoptosis in tissues, the TUNEL method and the cleaved caspase-3 (CCasp-3) IHC staining, when investigating the role of apoptosis in lymphoid tissues (20) PCVAD is multi-factorial and the presence of co-infections can increase and intensify clinical PCVAD (11). Porcine reproductive and respiratory syndrome virus (PRRSV), just like PCV2, has also been associated with apoptosis in infected host cells (8).

Increased disease severity is commonly observed when pigs are co-infected PCV2 and PRRSV (16). PRRSV is an enveloped RNA virus with single-stranded, positive-sense genome that belongs to the family Arteriviridae, genus Arterivirus (6). Two PRRSV types, 1 (European) and 2 (North American) exist based on genome sequence analysis (29). PRRSV infection renders the host unable to clear concurrent infections resulting in increased severity of disease and it is associated with enhanced PCV2 replication which results in increased amounts of PCV2 DNA in coinfected pigs (21). Both PCV2 virus have a tropism towards pulmonary alveolar macrophages (PAMs) and capable of infecting PAMs (7). The ability of PRRSV to replicate in PAMs (4) and the inability of PAMs and dendritic cells to degrade PCV2 (27) might lead to modification of macrophage function that could contribute to immune deregulation (24).

PCV2 subtypes a and b differ from each other genetically in a signature motif located between nucleotides 1472 and 1476 of open reading frame 2 (ORF2) (9). Chimeric DNA clones have been constructed with swapped signature motif regions that were used in in-vitro and in-vivo studies to determine the significance of the signature motif in virulence and it was concluded that clones containing the reciprocal signature motif had decreased virulence (3). Hence, an additional goal of the second study was to determine the importance of ORF2 and the PCV2 signature motif located in ORF2 in PCV2-PRRSV co-infection invitro. As PRRSV enhances PCV2 replication, there is a potential of increased shedding of PCV2 and increased PCV2 viral load in PRRSV-PCV2 co-infected pigs that might lead to


18

increased transmission rates of PCV2a or PCV2b in certain pig populations. No differences in shedding of PCV2a versus PCV2b were found in experimentally infected boars (15).

PCV2 vaccination is one of the most widely used vaccination strategies in growing pigs to date and existing PRRSV infections at the time of PCV2 vaccination is of concern to swine producers and veterinarians. Informations on the efficacy of PCV2 vaccination in PRRSV viremic pigs are scarse (1); (24).

The aim of our research was to investigate the prevalence of antibodies to PCV2 with boars from commercial farms in Serbia. There is no PCV type 2 seroprevalence investigated in boars on commercial farms so far in Serbia so far which have intended use for in-house reproduction.


On industrial farms, we conducted blood sampling in a total of 28 boars of

Landrace, Domestic Yorkshire and Duroc breed. All boars were in exploitation and following reproduction parameters: the number of inseminated gilts, the number of inseminated sows, repeated heats, the number of fertilized gilts, the number of fertilized sows, number of abortions, number of piglets farrowed, and the number of piglets born dead Blood samples were taken from the jugular vein. After spontaneous coagulation of blood at room temperature serum was separated by centrifugation and the aliquots were stored at -20°C till analysis. Serum anti-PCV2 IgM and IgG antibodies were detected by commercially available ELISA “INGEZIM circovirus IgG/IgM

®” (Inmulogia y genetica aplicada, s.a., Madrid, Spain) according

to the manufacturer instruction Statistical significance of 95% (p>0.05) was observed. Statistic date processing was done using Graphpad Prism 5

® package.

Statistics processing mainly included Landrace and Yorkshire. Duroc had a small number of boars for observations.


Of 28 4boars tested, 7 were negative to PCV2 (25%), positive 21 (75%) (Table 1).

Table 1 Prevalence of anti-porcine circovirus type 2 IgM and IgG antibodies in boars

Anti PCV2 Ab negative

Anti PCV2 Ab positive

Group of animals No No (%) No (%)

Toatal boars 28 7 25 21 75


19

We showed average total inseminated, average total farrowed, average piglets per litter, average live pigs per litter, average dead piglets per litter and average culled (Table 2).

Table 2

Reproductive parameters, sows and gilts: average total inseminated, average total farrowed, average piglets per litter, average live pigs per litter, average

dead piglets per litter and average culled

Breed No % Total inseminated (per boar)

Total farrowed (per boar)

Average Piglets per litter

Average Live pigs per litter

Average Dead piglets per litter

Average Culled

Duroc 2 7.15 78.50±21.92 69.5±16.25 14.84±0.54 14.14±0.44 0.71±0.11 4.50±3.54

Yorkshire 4 14.28 37.75±29.18 30±26.58 13.57±1.75 12.80±1.35 0.77±0.44 4.00±1.00

Landras 22 78.57 34.75±17.82 31±16.27 14.68±0.98 13.65±0.98 1.03±0.37 2.20±1.32

Sum 28 100

Fig. 1. Reproductive parameters of number of inseminated gilts, sows , total and

percentage of farrowing for gilts, sows and total

Reproductive parameters (Fig. 1) shows superior reproductive load of Duroc breed on tested farms. This parameters show breeding technology with Duroc as terminal breed fathers. Abortions rate were significantly higher on gilts and sows inseminated with Yorkshire compared to Landrace (p<0.05). Statistical significance in number of inseminated and number of farrowed sows and gilts is shown between all compared breeds (all with posthoc p<0.05). Numbers of inseminated and culled haven‟t showed statistical significance, and by comparing number of inseminated and number of abortions between selected breeds statistical significance have been found between Yorkshire and Landrace boars.


20

Of all stillborn piglets most of them was Landrace breed (Fig. 2) followed by Yorkshire and Duroc.

Fig. 2. Percentage of stillborn piglets per litter per breed compared

Reproductive parameters (Fig. 1) shows superior reproductive load of

Duroc breed on tested farms. This parameters show breeding technology with Duroc as terminal breed fathers. Abortions rate were significantly higher on gilts and sows inseminated with Yorkshire compared to Landrace (p<0.05). Statistical significance in number of inseminated and number of farrowed sows and gilts is shown between all compared breeds (all with posthoc p<0.05). Numbers of inseminated and culled haven‟t showed statistical significance, and by comparing number of inseminated and number of abortions between selected breeds statistical significance have been found between Yorkshire and Landrace boars.

Of all stillborn piglets most of them was Landrace breed (Fig. 2) followed by Yorkshire and Duroc.

Circovirus infection in our commercial farms caused significant losses due to reduced performance in growth and reproduction, treatment costs and culling. Such a situation makes production unprofitable. The term PCVAD (Porcine circovirus associated diseases) was introduced in 2006 to gather many diseases. Stankov (22) states that on our commercial farms since 2002 losses in the pig production on a monthly basis have reached to 9% and in fattening operation is increasing up to three times, mostly reaching the value to 15%. The most vulnerable were pigs weighing 40 to 60 kg. The clinical symptoms of the disease in weaned piglets was demonstrated by the second or third week after weaning in the form of weight loss and depression, skin pallor, increase in body temperature up to 41

oC, rapid and shallow breathing and pale yellow to golden-yellow aqueous

diarrhea and jaundice which was a constant finding. The clinical signs in fattening pigs is related to clinical picture in piglets, with hightlight on the respiratory


21

syndrome, bearing in mind that these animals were the affected with other pathogens (mostly Mycoplasma hyopneumoniae, and very rarely with Pasteurella multocida). The growht of fattening pigs decreased by 6 to 12 kg per pig.

Conclusions

Health check of breeding boars should be a complex process within the

implementation of health care measures on commercial farms. We have established the prevalence of antibodies to porcine circovirus

type 2 PCV2 with boars from commercial farms in operation.

Conflict of interest The authors declare that they have no conflict of interest.

Statement of ethical compliance

Experiment was done in compliance with Serbian Law on Animal Welfare

(Official Gazette of the Republic of Serbia No 41/09)

Aknowledgements

This research has been support by Ministry of Science, Education and

Technological development of the Republic of Serbia, project TR31071, III46002, and III46010.

References 1. Allan, G.M., Kennedy, S., McNeilly, F., Foster, J.C., Ellis, J.A.,

Krakowka, S.J., Meehan, B.M., Adair, B.M., Experimental reproduction of severe wasting disease by 141 co-infection of pigs with porcine circovirus and porcine parvovirus. J. Comp. Pathol. 1999a 121, 1-11.

2. Allan, G.M., McNeilly F., Meehan, B.M., Kennedy, S., Mackie, D.P., Ellis, J.A., Clark, E.G., Espuna, E., Saubi, N., Riera, P., Bøtner, A., Charreyre, C.E., Isolation and characterisation of circoviruses from pigs with wasting syndromes in Spain, Denmark and Northern Ireland, Vet. Microbiol., 1999b, 66, 115-123.

3. Allemandou, A., Grasland, B., Hernandez-Nignol, A.C., Keranflec'h, A., Cariolet, R., Jestin, A., Modification of PCV-2 virulence by substitution of the genogroup motif of the capsid protein, Vet. Res., 2011, 42, 54.

4. Bautista, E.M., Goyal, S.M., Yoon, I.J., Joo, H.S., Collins, J.E.,. Comparison of porcine alveolar macrophages and CL 2621 for the


22

detection of porcine reproductive and respiratory syndrome (PRRS) virus and anti-PRRS antibody. J. Vet. Diagn. Invest.1993, 5, 163-165.

5. Balasch, M., Segalés, J., Rosell, C., Domingo, M., Mankertz, A., Urniza, A., Plana-Durán, J.,. Experimental inoculation of conventional pigs with tissue homogenates from pigs with post-weaning multisystemic wasting syndrome, J. Comp. Pathol., 1999,121, 139-148.

6. Cavanagh, D. Nidovirales: a new order comprising Coronaviridae and Arteriviridae. Arch. Virol. 1997, 142, 629-633.

7. Chang, H.W., Jeng, C.R., Lin, T.L., Liu, J.J., Chiou, M.T., Tsai, Y.C., Chia, M.Y., Jan, T.R., Pang, V.F., Immunopathological effects of porcine circovirus type 2 (PCV2) on swine alveolar macrophages by in vitro inoculation, Vet. Immunol. Immunopathol, 2006, 110, 207-219.

8. Choi, C., Chae, C., 2002. Expression of tumour necrosis factor-alpha is associated with apoptosis in lungs of pigs experimentally infected with porcine reproductive and respiratory syndrome virus, Res. Vet. Sci., 2002, 72, 45-49.

9.Cheung, A.K., Lager, K.M., Kohutyuk, O.I., Vincent, A.L., Henry, S.C., Baker, R.B., Rowland, R.R., Dunham, A.G.,. Detection of two porcine circovirus type 2 genotypic groups in United States swine herds, Arch. Virol., 2007, 152, 1035-1044.

10. Ellis, J., Hassard, L., Clark, E., Harding, J., Allan, G., Willson, P., Strokappe, J., Martin, K., McNeilly, F., Meehan, B., Todd, D., Haines, D., Isolation of circovirus fromlesions of pigs with postweaning multisystemic wasting syndrome. Can. Vet. J., 1998, 39, 44-51.

11. Ellis, J., Clark, E., Haines, D., West, K., Krakowka , S., Kennedy, S., Allan, G.M.,. Porcine circovirus-2 and concurrent infections in the field, Vet. Microbiol., 2004, 98, 159-163.

12.Jacobsen, B., Krueger, L., Seeliger, F., Bruegmann, M., Segales, J., Baumgaertner, W., Retrospective study on the occurrence of porcine circovirus 2 infection and associated entities in Northern Germany, Vet. Microbiol. 2009, 138, 27-33.

13. Jantafong, T., Boonsoongnern, A., Poolperm, P., Urairong, K., Lekcharoensuk, C., Lekcharoensuk, P., Genetic characterization of porcine circovirus type 2 in piglets from PMWS-affected and -negative farms in Thailand, Virol J, 2011, 8, 88.

14. Krakowka, S., Ellis, J., McNeilly, F., Meehan, B., Oglesbee, M., Alldinger, S., Allan, G., Features of cell degeneration and death in hepatic failure and systemic lymphoid depletion characteristic of porcine circovirus-2-associated postweaning multisystemic wasting disease, Veterinary Pathology, 2004, 41, 471-481.

15.Madson, D.M., Ramamoorthy, S., Kuster, C., Pal, N., Meng, X.J., Halbur, P.G., Opriessnig, T., Characterization of shedding patterns of porcine


23

circovirus types 2a and 2b in experimentally inoculated mature boars. J. Vet. Diagn. Invest. 2008, 20, 725-734.

16. Pogranichniy, R.M., Yoon, K.J., Harms, P.A., Sorden, S.D., Daniels, M., Case-control study on the association of porcine circovirus type 2 and other swine viral pathogens with postweaning multisystemic wasting syndrome. J. Vet. Diagn. Invest.2002, 14, 449-45

17.Rosell, C., Segalés, J., Plana-Durán, J., Balasch, M., Rodríguez-Arrioja, G.M., Kennedy, S., Allan, G.M., McNeilly, F., Latimer, K.S., Domingo, M.,. Pathological, immunohistochemical, and in-situ hybridization studies of natural cases of postweaning multisystemic wasting syndrome (PMWS) in pigs. J. Comp. Pathol.1999, 120, 59-78

18.Rosell, C., Segalés, J., Ramos-Vara, J.A., Folch, J.M., Rodríguez-Arrioja, G.M., Duran, C.O., Balasch, M., Plana-Durán, J., Domingo, M., Identification of porcine circovirus in tissues of pigs with porcine dermatitis and nephropathy syndrome. Vet. Rec. 2000, 146, 40-43.

19.Resendes, A.R., Majo, N., Segalés, J., Mateu, E., Calsamiglia, M., Domingo, M., 2004b. Apoptosis in lymphoid organs of pigs naturally infected by porcine circovirus type 2. J. Gen. Virol.2004, 85, 2837-2844.

20.Resendes, A.R., Majo, N., Segales, J., Espadamala, J., Mateu, E., Chianini, F., Nofrarias, M., Domingo, M., Apoptosis in normal lymphoid organs from healthy normal, conventional pigs at different ages detected by TUNEL and cleaved caspase-3 immunohistochemistry in paraffin-embedded tissues. Vet. Immunol. Immunopathol.2004a, 99, 203-213.

21.Rovira, A., Balasch, M., Segalés, J., Garcia, L., Plana-Dúran, J., Rosell, C., Ellerbrok, H., Mankertz, A., Domingo, M., Experimental inoculation of conventional pigs with porcine reproductive and respiratory syndrome virus and porcine circovirus 2. J. Virol.2002, 76, 3232-3239.

22. Stankov, P., Stanimirov, D., Miriloviš, M. The effect of vaccination of sows against PCV2 viruses on brood size and farrowing rate. Proc, Symposium “Heaslth care, selection and reproduction pigs” Srebrno jezero, Serbia, 31 May-2 June 2013, pp 49-54.

23. Shibahara, T., Sato, K., Ishikawa, Y., Kadota, K.,. Porcine circovirus induces B lymphocyte depletion in pigs with wasting disease syndrome. Journal of Veterinary Medical Science 2000, 62, 1125-1131.

24. Sinha A. Interactions of porcine circovirus type 2 and porcine reproductive and respiratory syndrome virus, PhD thesis, Iowa State University, 2011.

25. Tischer, I., Rasch, R., Tochtermann, G., Characterization of papovavirus-and picornavirus-like particles in permanent pig kidney cell lines. Zentralbl. Bakteriol, 1974, 226, 153-167

26. Tischer, I., Mields, W., Wolff, D., Vagt, M., Griem, W., Studies on epidemiology and pathogenicity of porcine circovirus. Arch. Virol. 1986, 91, 271-276.


24

27.Vincent, I.E., Carrasco, C.P., Herrmann, B., Meehan, B.M., Allan, G.M., Summerfield, A., McCullough, K.C.,. Dendritic cells harbor infectious porcine circovirus type 2 112 in the absence of apparent cell modulation or replication of the virus. J. Virol. 2003,77, 13288-13300.

28.Wang, F., Guo, X., Ge, X., Wang, Z., Chen, Y., Cha, Z., Yang, H.,. Genetic variation analysis of Chinese strains of porcine circovirus type 2. Virus Res. 2009,145, 151-156.

29.Wensvoort, G., de Kluyver, E.P., Luijtze, E.A., den, B.A., Harris, L., Collins, J.E., Christianson, W.T., Chladek, D.,. Antigenic comparison of Lelystad virus and swine infertility and respiratory syndrome (SIRS) virus. J. Vet. Diagn. Invest. 1992, 4, 134-138.


25

EREDOPATHOLOGICAL STUDY OF A CAUCASIAN SHEPHERD PUPPY WITH GENETIC ABNORMALITIES

Gh. BONCA, G. OTAVA, SIMONA ZARCULA, V.ARDELEAN, C. MIRCU Banat‟s University of Agricultural Sciences and Veterinary Medicine ”King Michael I

of Romania” from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania


Summary

Histerotomy practiced for solving dystocia in a Caucasian Shepherd breed female, resulted in the "birth" of 8 puppies. Seven of them were healthy, and one had multiple abnormalities in the head region: abnormal collection of fluid, bounded by incompletely developed epithelium, prominent in dorsal cervical region, - right eyeball uncovered by eyelids and discontinuity of the palate.

The eredopatological investigation (clinical, cytogenetic and genealogical examination) concluded that newborn present two hereditary abnormalities: dermoid cyst and palatoschisis.

Key words: carnivores, Caucasian Shepherd, dermoid cyst, palatoschizis

One concern of our team is to bring new evidence of the growing frequence of undesirable genes and abnormalies generated by them in animal populations, farm animals (1, 2), and - as this example, companion animals.

Clinical, anatomical, cytogenetical and genealogical investigations performed in this case, illustrates the need for complex approach in order to have a precise etiological diagnostic and accurate conclusions.

Identifying the causes of genetic diseases does not solve the problem as long as owners only eliminate the affected animals and those that are carriers are maintained and reproduced.


The subject of the study is a newborn male gender, Caucasian Shepherd

breed, appeared from a full-term gestation, but with dystocia at parturition, along with seven other congeners, 5 females and 2 males, who were with no clinically anatomical development deviations.

When the fetus was extracted from the uterus during histerotomy was observed the presence of a slight depression in dorsal cervical region, with a prominent formation containing a liquid, covered with incomplete developed epithelium and the existence of eyeball slightly deviated from the orbital fossa and uncovered by eyelids. Subsequently, eredopathologic examination revealed also the presence of discontinuity of the palate.


26

The mother of the individ investigated was 4 years old and is was at the third birth; the first with 12 puppies, the second with 5 puppies, all without development deviations. Each time the father was different.

The male used in this breeding, from which the puppy with anomaly appeared had 14 months age at the time of mating.

The case was examined in the disciplines of Reproduction, obstetrics and veterinary gynecology - where the histerotomy was done and in Genetic and Eredopathology discipline from Faculty of Veterinary Medicine Timisoara. It was undergone specialized investigations consisting of: general clinical examination and on organs - in order to identify possible abnormalites in relation to those already established; - cytogenetic and genealogy examination.

Fragments from bone marrow were taken and processed by specific cytogenetic techniques. The examination of preparations aimed the quality of karyotype analyzed in order to detect any structural or numerical chromosome deviations. The examination was made using Caryotyping system „CytoVision” existing in the laboratory of cytogenetics and molecular genetics from Complex of Research Laboratories "Horia Cernescu" set up by the program "Development of infrastructure for research, education and services in the areas of veterinary medicine and innovative technologies for Ro 05. Code SMIS-2669 NSRF".


External clinical examination revealed two major abnomalities. First abnormality: - the presence of a soft structure, deformed, covered by

a skin epithelium, lacking the follicle, placed in the cervical dorsal region (fig. 1).

Fig.1. General appearance of dermoid cyst


27

Its dissection led to the identification of a short transcutaneous and transosseous conduct through the spinous process of the second vertebra, through vertebral canal (fig. 2).

Fig.2. Detail of dermoid cyst (communication place between vertebral canal and skin epithelium)

Based on these observations and descriptions from literature (5, 7), the

defect was diagnosed as dermoid cyst or pilonidal cyst. Often accompanied by different neurological signs, but dependent on the ventral area with which the sinus it is in relationship, in this case they couldn‟t be assessed due to the immediate postnatal death of the product.

Genetic determinism of abnormality being autosomal recessive, it‟s appearance proves that the newborn was homozyote for the undesirable allele, allele that disrupts the process of complete separation between the neural tube and adjacent regions of the skin during embryonic development, such as at the birth it seems like unnatural communication between rachidian canal and outside.

Taking into account the transmission mode of the defect, the puppies parents are heterozygots, so theoretically each one carrier of the allele. This was also confirmed by the genealogical analyses of the two partners. They have revealed the existence of a common ancestor: mother's father (TM) is at the same time the grandfather‟s (TT) male.

Described with accuracy by Hofmeyr (1963), at Rhodesian Ridgeback breed, a time it was considered that the defect is particular to this breed (6, 8, 9 and 10). Gradually, there were reports regarding dermoid cyst presence in other breeds, such as Shih Tzu and Boxer (13), Yorkshire terrier (5), Chow chow (3), Siberian Husky (4), English springer spaniel (12).

The case analyzed by us represents the first reporting of dermoid cyst in national specialty literature and first in Caucasian Shepherd breed.

The second abnormality: - the right eyeball was slightly exophtalmique and uncovered by eyelids. Apparently macrophtalmique, but in reality the sizes were similar to the left eyeball, that had normal position and covered by eyelids.


28

We have no explanation of the cause which could lead to deviation of the position of the eyeball and the lack of eyelids continuity which should cover it at birt

Clinical examination, namely the internal oral cavity, noted the lack of adhesion of the palate structures, on its whole length. The defect, known to many species as palatoschisis, represent an hereditary abnormality caused by a autosomal dominant gene in carnivores, whose involvement leads to maintaining the isolation of some of the shelvesthat in organogenesis will form hard palate. Given the dominant determinism is enough a single gene for its appearance. Based on the fact that both parents have the palate compact, it is hard to incriminate directly, one of them. However, accepting the premise that the Caucasian Shepherd breed is a breed with late sexual maturity completion, we believe that at the age of 14 months, the male age at the time of mating, its spermatogenesis activity was at begining. Deviations observed before sexual maturity aimed not only morphological changes of sperm cell but also its content, in this case, the DNA, which has suffered a mutation into a position in which the gene which provides mobility and local multiplication of shelves involved in the formation of palate. We suspect that the father would be responsable for the defect transmission.

Also through internal clinical examination it was noted that all the viscera from the thoracic and abdominal cavities had shape and size corresponding to a newborn.

The results of microscopic analysis of the bone marrow cells, found in metaphase, revealed the same number of chromosomes, 78, specific to carnivores and the absence of chromosome structural rearrangements.

Conclusions

Newborn analyzed is in genetic terms carrier of genetic deffect which

determine disruption of embryonic development process from ectoblastic area in two areas:

- the common one of which differentiates the neural tube and peripheral epitheliu

- the one of differentiation and growth of mandibular shelves Abnormalities observed are the result of undesirable genes, autosomal

recessive for dermoid cyst and autosomal dominant for palatoschisis. Complexe malformation cases require an interdisciplinary approach to

specify the extension of them beyond simple observation.

References

1. Bonca, Gh., Lungu, I.V., Mircu, C., Violeta Igna, H.Cernescu, V.Ardelean, G.Otavă, Observaţii privind incidenţa unor eredopatii la metişi birasiali la suine. Lucr.Şt.Med.vet. Timişoara, 2005, vol. XXXVIII, p. 477-480.


29

2. Bonca, Gh., Cristescu, A., Zarcula, Simona, Urian, R., Mircu, C., Ardelean, V., Observaţii clinice privind incidenţa unor eredopatii în două populaţii de ovine din rasele Merino-Landschaf şi Merino-Fleischaf. Rev. Rom.de Med.Vet., 2012, 23, 2, 165-170.

3. Booth, M.J. Atypical dermoid sinus in a chow chow dog. J S Afr Vet Assoc 1998, 69, 102-104.

4. Cornegliani, L, Ghibaudo, G., A dermoid sinus in a Siberian Husky. Vet Dermatol, 1999, 10, 47-49.

5. Fatone, G, Brunetti, A, Lamagna, F., Dermoid sinus and spinal malformations in a Yorkshire terrier, diagnosis and follow-up. J.Small Anim Pract, 1995, 36, 178-180.

6. Gammie, J.S., Dermoid sinus removal in a Rhodesian Ridgeback dog. Can Vet J, 1986, 27, 250-251.

7. Hofmeyr, C.F.B., Dermoid sinus in the Ridgeback dog. J Small Anim Pract 1963; 4 (Suppl), 5-8.

8. Kasa, F., Kasa, G., Kussinger S., Dermoid sinus in a Rhodesian ridgeback. Case report. Tierarztl Prax 1992; 20, 628-631.

9. Lambrechts, N., Dermoid sinus in a crossbred Rhodesian Ridgeback dog involving the second cervical vertebra. J S Afr Vet Assoc 1996; 67, 155-157.

10. Marks, S.L., Harari, J., Dernell, W.S., Dermoid sinus in a Rhodesian ridgeback. J Small Anim Pract, 1993, 34, 356-358.

11. Pavaux, C.l., Anatomie du development, embrion-notions de teratogenese; foetus et anexes foetales. E.N.V.de Toulouse, 1987.

12. Pratt, J.N., Knottenbelt, C.M., Welsh, E.M., Dermoid sinus at the lumbosacral junction in an English springer spaniel, J Small Anim Pract, 2000, 41, 24-26.

13. Selcer, E.A, Helman, R.G,. Selcer, R.R., Dermoid sinus in a Shih Tzu and a boxer, J Am Anim Hosp Assoc, 1984, 20, 634- 636.


30

DIFFERENT WAYS OF FEEDING TURTLES (CHRYSEMYS SCRIPTA ELEGANS)

OLIMPIA COLIBAR, E. TÎRZIU, ILEANA NICHITA, MARIA MOT, DENISA SORESCU

Banat‟s University of Agricultural Sciences and Veterinary Medicine ”King Michael I

of Romania” from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania

[email protected]

Summary

The turtle with red temples or Florida (Chrysemys SCRIPTA ELEGANS) although originally from North America, is now becoming more widespread in Europe and in our country. For this reason feeding them in captivity become a challenge. Two batches of turtles in 2 months of age were fed for 10 weeks with beef. Additionally batch E1 was fed with Tubes (genus Tubifex) and batch E2 was fed with dry crayfish (genus Gammarus). Body mass growth rate highest in recorded E1 batch (18.116 ± 0,588 g average final table) and batch E2 obtained lower performance, making only reached 89.23% by weight of the first batch (16.166 ± 2.588 average final table g). Feeding turtles with live food (Tubifex) is top than with dry food (with 10.77%). It is found that, in general, variability in batch E1 increases with age. This could be possible due to competition between individuals of the same batches for turtle.

Key words : turtles, feeding, tubes, beef

Turtles are reptiles belong to the order Chelonian. They appeared long before the era of the dinosaurs and have a considerable age (about 200 million years ago). Chelonian Order now comprises about 250 species, divided into genera and families, those rated as most important (1, 5, 8, 10, 15). Among them in recent decades has increased the number of turtles bred in captivity for their exotic appearance. Although their acquisition became easy their feeding is a problem and specific pathology (1, 2, 3, 4, 6, 12).


Feeding turtles varies depending on the species, maintenance conditions,

financial possibilities and the level of training of the owner. Food should be more varied and suitable tortoise that we have. Hey eat aquatic plants, small fish and decomposed material. In the wild, young turtles tend to eat 70% and 30% animal matter plants, but adults eat 90%, 10% plant and animal matter. The turtles are omnivores, meaning they eat plant and animal substances generally eat aquatic insects, snails, fish, crustaceans, molluscs and various plants (16).


31

10 turtles Chrysemys scripta elegans (turtles with red temples) were divided into two homogeneous batches (L1 and L2 batches). Both batches have been to pick the basic food fresh beef. Turtles from the first batch received every day a supplement of the genus Tubifex worms and those in batch two dry crayfish (genus Gammarus).

Animals were identified based on individual design. During the experiment, the turtles were kept in an aquarium; each compartment was equipped with heating, specially designed for this purpose (heater with a thermostat), so that they have minimized temperature variations between the two experimental groups. A measure aquaterrarium compartment 20 l fill level was 1/3.

In each compartment were provided dry refuge spaces. The animals were individually weighed at the end of each experimental week.

The food administered was daily weighed. At the beginning and at the end of the experimental period, body measurements were made (length / width and length of the body shell).


Turtles along with fish and other reptiles are animals with varying body

temperature – poikilothermic. When the temperature is too high, reduce heart rate and blood flow is slower. If the body temperature should increase occurs an accelerated heart rate and blood flow is faster. In table 1 are given optimum temperatures and critical temperature main species of turtles.

Table 1 Optimal temperatures and critical temperature for different species of turtles

(7, 9, 13, 14) Species

Temperature

0C

Optimal Critical

EMYS ORBICULARIS

24-36 40-42

TESTUDO HERMANNI GMELIN

25-30 38-40

TESTUDO GRAECA IBERA PALLAS

24-28 38-40

CHRYSEMIS SCRIPTA ELEGANS

24-28 38-41

KIMIXYS BELLIANA

28-30 40-44

All animals received the same amount of fresh beef, the same quality sliced fine in an amount of 3.2 g at the beginning of the experiment, which is gradually increased in such a way that at the end of the experiment each batch consumed 4.9 g / week.


32

The amount given live food supplement / batch / wk. It increased from 3.2 g at 4.9 g (for batch L1) and the amount of dry crayfish from 1.8 g to 2.6 g (for batch L2) (table 2).

Table 2 Quantity of food given during the experimental period

Week Batch Tubifex (g) Gammarus (g) Beef (g)

I L1 3.2 - 3.2

L2 - 1.8 3.2

II L1 3.4 - 3.4

L2 - 2.0 3.4

III L1 3.5 - 3.5

L2 - 2.1 3.5

IV L1 4.1 - 4.1

L2 - 2.1 4.1

V L1 4.2 - 4.2

L2 - 2.1 4.2

VI L1 4.7 - 4.7

L2 - 2.6 4.7

VII L1 4.2 - 4.2

L2 - 2.1 4.2

VIII L1 4.9 - 4.9

L2 - 2.1 4.9

IX L1 4.9 - 4.9

L2 - 2.1 4.9

X L1 4.9 - 4.9

L2 - 2.1 4.9

Gain body weight highest in recorded batch E1 (average 18.116 ± 0,588 g

final table). Batch that was fed live food (Tubifex). Batch E2, who received dry food (crayfish), received lower performance, making only reached 89.23% by weight of the first batch (16.166 ± 2,588g average final).

To find out if there is a correlation between the mass of food consumed and the average weight of consignments we correlated the two sets of data (the Tubifex cool dry mass and an average weight of consignments) obtaining a linear regression equation characterized by a correlation coefficient. It is noted that in the first group have a strong dependency between mass and weight of the batch L1 Tubes, r = 0.94; and if fed with cool dry L2 batch we can say that a correlation coefficient r = 0.39 have a dependency between the two sets of experimental data.

Conclusions

Turtles with red temple can grow in good conditions in captivity. The most important are those levels recommended temperature, providing water for swimming but a dry refuge.

The most important seems to be the proper nutrition for both growth and maintenance of health.


33

Since the disease appeared not consider that diet Applied Nutrition was right. Apparently raw foods caused greater productive performance with 10.77%. Replacement feeding is gradually after a period of adjustment.

References

1. Blair, E. M., Nutritional disease, Reptiles, 3, 1997. 2. Blair, E. M., Blister disease, Reptiles, 3, 1997. 3. Blair, E. M., Infectious stomatitis, Reptiles, 3, 1997. 4. Blair, E. M., Septicemic cutaneous ulcerative disease, Reptiles, 3, 1997. 5. Brehm, J., Lumea animalelor, Ed. Stiinţifică, Bucureşti, 1964. 6. Brogard, Y., Les maladies des reptiles, Ed. Point Veterinaire, Maison-

Alfort, 1987. 7. Bud, I., Vlaic, A., Cornoiu, I., Broaştele ţestoase şi alte animale de

companie, Ed. Promedia-Plus, Cluj-Napoca, 1997. 8. Caporoso, F., TNT - Tortoise diet information, Tortuga Gazette, 1989. 9. Colibar Olimpia, Patologie exotică, Lito USABMV, 1999. 10. Kirkpatrick, D. T., An overview of common semi-aquatic turtles, Reptiles,

1996. 11. Mader, D. R., Palazzola, C. M., Landerman, K., Shell repair in chelonians,

Tortuga Gazette, 12;6. 1991. 12. Wallach, J.D., Medical care of reptiles, Journal of the American Veterinary

Association, 155, 1017-1034, 1969. 13. *** California Turtle & Tortoise Club - Care of water turtles, 1997, 3. 14. *** California Turtle & Tortoise Club - Care of box turtles, 1997, 3. 15. *** Poland R.H.C. - Sea turtle clasification, Euro turtle outlines, 1999, 5. 16. *** http://ro.wikipedia.org/wiki/Țestoasa_de_apă_cu_tâmple_roși,2015.


34

COMPARATIVE APPLICATION OF TWO MUMMIFICATION TECHNIQUES ON RABBIT AND CAT CADAVERS

IOANA DUMITRU, IRINA IRIMESCU, F. SILAGHI, A. DAMIAN

University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Faculty of Veterinary Medicine, 400372, Mănăştur Street No. 3-5, Cluj-Napoca, Romania


Summary

Human and animal cadaver preservation techniques have been known since antiquity, starting with the most basic ones, like freezing or simple mummification, up to artificial mummification via arterial injection and immersion. Several combinations of chemical are used to achieve this, such as preservatives, to maintain tissue structure, disinfectants, to stop decomposition, humidifying agents and coloring agents. This research aimed to obtain two mummies, one of a rabbit and one of a cat, using two improved techniques. The material used were: one cat cadaver, one rabbit cadaver, dissection kit, 7%, 10% and 15% formalin solutions, technical glycerin, technical ethylic alcohol, coloring agents. Cat body mummification process: it was successively injected with 7% and 15% formalin solutions, respectively, allowing it to fixate post-injection for 5 and 10 days, respectively. The skin and subcutaneous conjunctive tissue were then removed, and the musculature highlighted. The body was once again mounted and dehydrated by freezing for 14 days. After de-freezing it, the technical glycerin and the colorant agents were applied. The piece was kept on the base to dry until the induction of the mummification. Rabbit body mummification process: it was first injected with 10% formalin solution, mounted on a base, left to fixate for 3 days, injected with technical ethylic alcohol, re-mounted and left to degrease and fixate for 5 days. Next, the skin and the subcutaneous conjunctive tissue were removed, underlining the muscles. We re-injected them with technical ethylic alcohol, re-positioned the piece on the base and froze it for 10 days, to continue the degreasing process. The piece was then left at room temperature, adding an acrylic coloring agent, by brushing. The body was mounted on the final base and dried with the aid of a ventilator. We conclude by underlining the fact that both these preservation methods met the requirement of maintaining the anatomical characteristics.

Key words: mummies, cat, rabbit

Mummification is a preservation technique that has accompanied the scientific discipline of human and animal anatomy since their conception. It has been observed and described as both a natural occurrence and as a man-induced process.

Natural accidental mummification is possible, if certain conditions are met (dry air, appropriate ventilation and high temperatures). It can even appear on very sensitive type of tissues with a low preservation threshold, such as nervous tissue (4). The duration of natural mummification varies according to external factors and state of the body from one to twelve months.


35

Induced mummification has also been known to man since ancient times. Armstrong (1) states that “the methodology behind mummification is encompassed by the life of the King "Osiris" who brought civilization to Egypt. Ancient Egyptians believed that an intact preserved body was necessary for the soul to live forever”. Another author notes that the interest to preserve biological tissues accompanied the recognition of anatomy as a scientific disciple in ancient Alexandria (5).

According to Putnam (3), a mummification technique was first recorded by the Greek historian Herodotus (450 BC). This process started out as a simple dissection, but in time it became a complex process, performed only by embalmers (6). Today, mummification is still a valid and useful technique, especially for the production didactic materials used for teaching anatomy, and benefits from the introduction of modern preservatives.

By applying two improved mummification techniques within our study, we aimed to test their efficacy, recording the processing time necessary for obtaining the mummies and the level of anatomical characteristics maintenance.


The study was performed in the Comparative Anatomy Laboratory of the

Faculty of Veterinary Medicine of Cluj-Napoca The materials that we have used consisted of: a cat cadaver, a rabbit

cadaver, dissection kit, 7%, 10% and 15% formalin solutions, technical glycerin, anti-mold solution spray, coloring agents and technical ethylic alcohol.

The first step of mummifying the cat body consisted of injecting it with a 7% formalin solution, mounting it on a base and leting it fixate for 5 days; the body was again injected with a 15% formalin solution and then fixated for 10 days (Fig.1).

Fig. 1. Cat body injected with formalin for fixation.

Then, the skin and subcutaneous conjunctive tissue were removed, and the musculature highlighted. The body was again mounted on the base and frozen for 14 days as means of dehydration (Fig. 2).


36

Fig. 2. Musculature highlighting and dehydration

After dehydrating the body, it was left at room temperature, followed by the addition of the technical glycerin and of the coloring agent (Fig. 3). We left the piece to dry until we noticed the induction of the process of mummification.

Fig.3. Adding the technical glycerin and the acrylic coloring agents

The rabbit cadaver was injected with a 10% formalin solution, mounted on

a base and allowed to fixate for 3 days. We then injected it with technical ethylic alcohol, positioned the body on the base, sprayed it with a anti-mould solution and left it to degrease and fixate for 5 days (Fig. 4).


37

Fig. 4. Rabbit body injected for fixation and dehydration

The next step consisted of removing the skin and the subcutaneous conjunctive tissue, highlighting the musculature, injecting it with technical ethylic alcohol and freezing the body for 10 days, to continue the processes of degreasing and dehydrating (Fig. 5).

Fig. 5. Musculature highlighting and technical alcohol injection

After the dehydration period, the body was removed from the freezer and left at room temperature for 1 day, and then we added the acrylic coloring substance by brushing. The body was positioned and dried with the aid of a ventilator (Fig.6).


38

Fig. 6 Cadaver coloring, positioning and drying


The two techniques were assessed both by comparing them as we applied

them and by comparing the state of the two mummies 4 months after the processing, both being kept and handled in the same conditions. We noticed that both techniques led to very satisfactory results, with certain differences.

In both 4-months old mummies, the anatomical characteristics necessary for didactical purposes were well kept and neither of them presented signs of depreciation, showing better resistance to being handled, than classical mummies. Also, neither of them presented marks of degradation due to insect attacks or to mold infestations.

When compared to classic mummification techniques, through which pieces were colored using oil based substances, to compensate the loss of the original tissue colors (2), the acrylic substances used in the two applied techniques helped retain a better intensity of the coloring (Fig. 7 and 8).

A difference in quality between the two techniques was revealed by the maintenance of a brighter luster in the cat mummy, by comparison to the rabbit mummy, due to the application of technical glycerin on the former.

From the point of view of the processing time, we can mention that in both cases the techniques were painstaking, maneuvers demanded patience from the practitioner and the pieces were obtained over rather long periods of time.

However, we have noticed a difference in the processing time between the two techniques: the cat body mummification was completed in approximatively 90 days, and the rabbit body mummification was ready in only 30 days; this duration difference was due in part to the use of technical alcohol in the latter and to the step of drying the rabbit cadaver with the aid of the ventilator as opposed to the temperature room drying of the cat mummy.


39

Fig. 7. Rabbit and cat mummies

Fig. 8. Pony mummy

Conclusions

Analyzing the results obtained by applying the two modified mummification

techniques led to the following conclusions: Both modified technique resulted in mummies fit for didactical use, as they

present better durability to direct handling, and better highlighting of the desired anatomical characteristics.

Formalin solutions and technical ethylic alcohol are equally effective in tissue preservation and in protecting it against insect attacks and mold infestations, thus indicating that the use of a anti-mold solution is not mandatory.

The technical ethylic alcohol, however, demonstrated better degreasing and dehydrating properties, helping reduce the processing time.

In the case of the cat mummy, using the technical glycerin (by with it replacing a formalin injection step), has sped up the process and also improved the aspect of the final product, by offering it a better luster.

When assessing color resistance, acrylic solutions have presented a better intensity than traditional coloring.


40

With regards to the duration of the process, which is one of the great disadvantages of mummification, we strongly recommend using a ventilator in the final drying stage, as we have concluded that it can reduce the necessary time up to one third.

Acknowledgements

This paper was published under the frame of European Social Fund, Human Resources Development Operational Programe 2007-2013, project no. POSDRU/159/15/S/132765.

References

1. Armstrong, K., A history of God: The 4,000 year quest of Judaism, Christianity and Islam. New York: Ballantine Books, 1993, p. 1-45.

2. Dumitru, Ioana., Irimescu, Irina., Tuns, F., Csibi, Dalma., Iurcuţ, Alina, Codea, R., Damian, A., Comparative Study of Two of the Main Conservation Techniques of Anatomical Pieces, Vol 69, No 1-2, Bulletin of University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca, 2012, 82-90

3. Putnam, J., Mummy: An eye witness guide. London: Dorling Kinderslay, 1993, p. 1-64.

4. Radanov, S., Stoev, S., Davidov, M., Nachev, S., Stachev, N., Kirova, E., A unique case of naturally occurring mummification of human brain tissue, Internatioanl Journal of Legal Medicine,1992, 105(3), 173-175.

5. Singer C., The great Alexandrians about 300BC - 250BC. A short history of anatomy and physiology from Greeks to Harvey, the evolution of anatomy. New York: Dower Publications; 1957, p. 28-29.

6. Yardley, M, Rutka, J., Rescued from the sands of time. Interesting otologic and rhinologic findings in two ancient Egyptian mummies from the Royal Ontario Museum. J Oto Laryngol, 1997, 26, 379-383.


41

DIETARY SELECTION IN SHEEP AND GOATS UNDER FREE-GRAZING AND PENNED CONDITIONS IN THE NEGEV, ISRAEL

S. EL-MECCAWI

1, M. KAM

2, A. A. DEGEN

2

1Achva Academic College. MB - Shikmim, 79800, Israel

2Jacob Blaustein Institutes for Desert Research, Ben Gurion University of the

Negev, Beer Sheva 84105, Israel E-mail: [email protected]

Summary

The foraging behaviour and dietary selection of free-ranging Awassi sheep and Negev goats when shepherded in the Negev Desert was determined. Measurements were made from the beginning of February, following winter rains and emergence of annual plants, to the end of March, after the herbaceous vegetation dried up. Since sheep are grazers and goats are intermediate feeders, we predicted that goats would browse more and consume proportionately more browse than sheep. These predictions were only partially supported. It was concluded that vegetation availability and foraging habits affected dietary selection. Both sheep and goats only grazed when herbaceous plants were abundantly available; differences between ruminant species were apparent when herbaceous plants became scarcer, at which time goats browsed more and consumed proportionately more browse than sheep.

In a laboratory cafeteria trial, six fodder plants consisting of two leguminous trees, Acacia salicina and Acacia saligna, a leguminous shrub, Cassia sturtii and three halophytic shrubs, Atriplexcanescens, Atriplexhalimus and Atriplexnummularia were offered ad libitum

to four fat-tailed Awassi sheep and four local Negev goats. Leguminous plants are characterized by high tannin contents and halophytes by high ash contents. We asked whether: (1) fodder selectivity by these small ruminants and (2) the ranking and proportionate feed intakes differed between sheep and goats. Total dry matter intakes were similar in sheep and goats and feed selection in goats tended to be positively correlated with that of sheep. Acacia saligna was the most preferred feed in both small ruminants and the two Acacia species comprised more than 86% and 70% of dietary intakes in goats and sheep, respectively.

Key words: sheep, goat, free grazing

Today, there are approximately 200000–300000 sheep and goats in the Negev Desert. The sheep are predominantly Awassi, a fat-tailed breed well-adapted to desert conditions, and the goats are crossbreds, known locally as baladi or Negev, and derived mainly from the Sinai and Mountain breeds. They are generally raised by Bedouin as mixed flocks of 50–200 head, although there are several flocks of over 500 head (27). Most flocks free-range away from the Bedouin homestead from about February, following winter rains and the emergence of herbaceous plants, and continue to free-range as long as possible. However, unpredictable rainfall and low primary production make the raising of livestock in these areas tenuous. Even in favourable rainfall years, animal performance can be


42

poor due to a lack of adequate energy intake in the dry season, and, in the event of drought, livestock mortality can be high (25).

In contrast, trees and shrubs remain green all year, even during droughts (45). Leaves/phylodes of leguminous trees and shrubs are rich in crude protein (CP) and can be particularly important in the dry, summer season when only poor quality roughage or forage and mature herbage are available. Halophytic shrubs, such as Atriplex spp., also can exist under extreme desert conditions, thriving on poor, saline soils (37). In spite of these positive attributes, trees and shrubs are usually not readily consumed by livestock. In addition to high fibrous material, low intakes are primarily due to plant defense mechanisms, notably tannins (38), which limit consumption by the grazing animal. Tannins form precipitates with proteins resulting in the formation of indigestible complexes (31). Halophytic shrubs contain high mineral concentrations, in particular sodium chloride, which limit their intakes (2) and Atriplex spp. also contain high concentrations of oxalate which can be toxic to livestock (1). Consequently, it is generally accepted that foliage from trees or shrubs cannot serve as the sole source of feed for livestock but can serve as a valuable supplementary fodder, in particular during droughts (17, 42, 47).

There is evidence that both sheep and goats are highly selective when offered a mixed diet (48). However, sheep are primarily grazers whereas goats are intermediate feeders (32) and they differ in their dietary selection (8, 33), feeding behaviour and in their physiological characteristics that are related to feed utilization (20). Goats are better able to use feeds containing secondary anti-nutritional agents, such as tannins, (29, 30) and they feed on trees and shrubs more readily than do sheep (40). Although there is some overlap in their dietary selection, their intakes can differ substantially and can complement each other. Consequently, to take better advantage of natural pasture and use more of the vegetation as feed, sheep and goats are often raised together in many free-ranging systems (3).

In the field, we observed a mixed flock of sheep and goats from the emergence of herbaceous vegetation until after it dried out. Based on the foraging habits of sheep and goats, we predicted that goats would spend more time browsing and that their dietary selection would contain a higher proportion of browse than would sheep. To test these predictions, foraging behaviour and dietary selection of sheep and goats shepherded in the Negev Desertwere measured. In addition, in the laboratory, we offered six tree and shrub fodders to sheep and goats in a cafeteria trial to determine (1) fodder selectivity by these small ruminants and (2) whether the ranking and proportionate feed intakes differed between sheep and goats.


43


Grazing trial The study was conducted in the NegevDesert, about 4 km northeast from

the city Beer Sheva (31°23'N, 34°78'E, 207masl). The Negev is characterized by a short annual growing season following winter rains, mainly from November–March. Average annual rainfall at the study site is 204 mm. Available herbaceous vegetation biomass was determined once each week for 9 weeks from the last week of January to the last week of March, following Tadmor et al. (44).

A mixed flock of 64 Awassi sheep and 47 Negev goats shepherded by two Bedouins was studied. The animals were watered, then free-ranged on natural pasture for 11 hours daily, from 07.00–18.00 h, after which time they were watered and corralled overnight. Six males of each ruminant species served as focal animals for time activity budget measurements. Each of the focal animals was observed for 5min every hour for 2 days per week. Time spent grazing, browsing, standing, walking and sitting were recorded. Proportional dietary food composition was determined using n-alkane faecal analysis in comparison with n-alkane profiles of available plants. Faecal grab samples of each of the six focal sheep and six focal goats were taken twice daily, once in the morning and once in the evening, and then all samples within each animal within each week were pooled. In addition, three samples from each plant were collected each day and pooled per week. Pooled faecal and vegetation samples were dried at 60 °C to constant mass.

Laboratory study Leaves or phylodes were collected from six mature plants from each of six

species in March-April in the same year in the Negev desert. Phylodes from Acacia salicina and Acacia saligna were hand collected from branches lopped from trees at WadiMashash (34°47' N, 31°14' E), a research station some 20 km south of Beer Sheva. Leaves from Atriplexcanescens, Atriplexhalimus, Atriplexnummularia and Cassia sturtii were hand collected from shrubs at the Migda Dryland Experimental Station (34°25' N, 31°22' E), some 20 km west of Beer Sheva.

Phylodes and leaves of the six fodder plant species were air-dried prior to the study. Cafeteria trials to determine fodder selection were carried out on four male, fat-tailed Awassi sheep (41.1±3.2 kg) and fourmale, Negev goats (36.5±2.4 kg). All animals were 1.5 – 2.0 years old and were randomly picked from a large free-grazing Bedouin flock of sheep and goats. The animals were allowed three weeks to acclimatize to penned conditions during which time and during the study, the sheep and goats were offered a maintenance diet of lucerne hay, wheat straw and some concentrate feed. Previous to dietary selection measurements, each animal was deprived of food for 12 hours overnight (17:00 to 07:00). In the morning, six feeding buckets were placed at random in each pen with each bucket containing 500 g of one of the fodder species. The animals were allowed to feed on the six fodders for 15 minutes after which time the refusals of each fodder species


44

were recorded. This procedure was repeated for 5 consecutive days. Tests of randomness in time-series analyses (24) showed that repetitive trials had no effect on the intakes of either the sheep or goats, and that there was no ranking pattern established in either species. Therefore, the average intake within each animal for each of the feeds was used for further analyses.

Dietary ratio and Jacobs' (22) selectivity index (Di) were used to determine food preference of the animals (35) using the relationship:

Di= (DRi - RAi) /(DRi + RAi - 2 RAiDRi) where DRi (feed ratio) is the ratio between dry matter intake (DMI) of a

particular food (DMIi) and total DMI of feed (DMIp): DRi= DMIi / DMIp. and RAi (relative abundance) is the ratio between dry matter offered of an

individual food item (DMOi) and dry matter of total feed offered (DMOp): RAi = DMOi / DMOp. Jacobs' selectivity index is symmetrical around "0" (no selectivity) and

ranges from "-1" (maximum negative selectivity) to "+1" (maximum positive selectivity). Feeds with negative indices indicate that their proportional intakes are less than the proportion offered; feeds with an index of "0" indicates that proportional intakes are similar to the proportion offered and feeds with positive indices indicate that proportional intakes are greater than the proportion offered (23). Mean values were analyzed for differences between sheep and goats and among fodder species.In addition, we compared fodder choices between sheep and goats using independent distances. We calculated Euclidean distances of the preference index for each sheep and goat, and used a Mantel test (28) with 9999 iterations to calculate the probability of this comparison (GenAlex software package version 6 for Excel).


Field Study Herbaceous vegetation biomass previous to winter rains in January was 20

g DM/m2

and increased rapidly, mainly due to emerging annuals, within 5 weeks to 180 g DM/m

2 during February. From the middle of the foraging period to the end of

March, herbaceous vegetation decreased and, concomitantly, the vegetation available for sheep and goats changed from mainly herbaceous vegetation at the beginning of the foraging season to a higher proportion of shrubs and trees at the end of the season.

Fibre contents were higher in herbaceous plants than in shrubs and trees and condensed tannins were higher in trees than in shrubs and herbaceous plants. In vitrometabolizable energy (IVME) yield was higher in herbaceous plants and shrubs than in trees, but average IVME was similar between sheep and goat rumen fluids for each of the plant groups.


45

Within periods (weeks), sheep and goats spent similar proportions (P = 0.58) of their time at pasture for foraging (both grazing and browsing); 0.69 (7.6 h) for sheep and 0.71 (7.9 h) for goats, at the beginning of the season (week 2; W2) and 0.45 (5.0 h) for sheep and 0.54 (5.9 h) for goats, at the end of the season (W9). However, there was a significant difference among periods in the time spent browsing (P< 0.001). In W2 neither sheep nor goats browsed; browsing commenced during W4 when goats and sheep browsed 0.08 (0.9 h) and 0.07 (0.7 h) of the time allotted for foraging, respectively. Browsing increased to 0.20 (2.2 h) and 0.12 (1.3 h) during W8 and 0.29 (3.1 h) and 0.19 (2.1 h) during W9, for goats and sheep, respectively. At this latter period, grazing was reduced to 0.26 (2.9 h) in sheep and 0.25 (2.8 h) in goats of the time allotted for foraging. Comparison of time budget matrices using Mantel analyses showed a similar foraging pattern between sheep and goats from W2 (SSx =1.234; SSy=1.089; SPxy=1.158; Rxy = 0.99, P< 0.005) until W8, however this was not the case at W9 when different patterns (SSx=0.053; SSy=0.051; SPxy=0.011; Rxy=0.202; P = 0.214) emerged between these two ruminants. In this latter period, grazing time was similar between sheep and goats, but browsing time was higher in goats.

Dietary composition based on faecal n-alkane analyses during W4, W5, W6 and W8 revealed that herbaceous vegetation was composed of a higher proportion of dietary intake in sheep than in goats at all times. In W8 both small ruminants consumed mainly browse, which contributed 0.85 of the DM intake in goats and 0.62 of the DM intake in sheep. The browse selected was mainly the two shrub species, Atriplexhalimus and Lyciumshawii.

We predicted that goats would spend more time browsing and would consume a higher proportion of browse to herbaceous plants than would sheep. These predictions were only partly supported. In fact, for most of the season, the foraging pattern was similar between sheep and goats and only towards the end, at W9, did patterns differ significantly between these two ruminants. Herbaceous vegetation that emerged after winter rains were preferred by both sheep and goats, and were consumed exclusively for the first 2 weeks (W2 and W3). Differences in foraging pattern and in dietary selection between sheep and goats became apparent only when herbaceous plants dried out and availability decreased substantially.

The time spent foraging throughout this study was similar between sheep and goats in each period, between 5 and 9 h, and within the range reported in other studies of free-ranging, co-grazing sheep and goats (see review by 3). The decline in time of foraging for both sheep and goats from February to March in the current study corresponded well with the decline in feeding in these small ruminants from the rainy to dry season in the Sahelian area (40). However, in contrast to the current findings, goats in other studies did not change feeding time with season. For example, lactating goats in northern Senegal, a semi-arid area, foraged for over 0.80 of pasture time throughout the year (9) and goats in Malawi, a semi-


46

humid area, spent 0.33 and 0.37 of their time feeding in the wet and dry periods, respectively (4).

The current findings on foraging pattern differed from those in the Sahelian area, at least for goats. Goats in the current study generally grazed more than they browsed and, in fact, only grazed with abundant herbaceous vegetation. Only in W9 did they spend more time browsing than grazing, 0.29–0.25 of the foraging time allotted. In contrast, goats in the Sahelian area of Burkina Faso always browsed more time than they grazed, even in the rainy season when they consumed their highest proportion of herbaceous vegetation in their diet (40). Likewise, goats in the Sahelian zone of Cameroon (32) and in semi-humid Malawi (4) always browsed more than they grazed. Some of the differences found among sites in time spent grazing and browsing could be due to the shepherds, as their handling of the animals can affect dietary selection (41).

The foraging behaviour of sheep in the Sahelian zone was similar to that of sheep in the Negev in that at both sites, sheep always spent more time grazing than browsing. In the Sahelian zone of Cameroon, sheep always grazed approximately 0.67 of foraging time (32). The behaviour of the Negev sheep was also similar to that of sheep in a semi-arid area of South Africa. The sheep consumed only herbaceous vegetation in the wet season and included browse in the dry season only (33).

In a study of foraging behaviour of sheep and goats on native pasture in Mediterranean kermes oak shrublands, goats consumed a higher proportion of browse than herbaceous vegetation than did sheep, as was found in the current study. However, unlike in the current study, goats always consumed more browse DM than herbaceous DM, even in the wet seasons, and sheep always consumed more herbaceous DM than browse DM, even in the dry seasons (36). In the current study, dietary selection in W4, W5, W6 and W8 was measured. In W4, goats consumed relatively more dry herbaceous vegetation than DM of browse, but the opposite was found in the latter three periods. Yet the goats spent less time browsing than grazing in all these periods. Similarly, sheep in W8 selected proportionately more browse DM than herbaceous DM yet spent less time browsing than grazing. In W8, time spent browsing for goats was about 0.30 of time feeding, but browse intake was 0.85 of total DM intake and for sheep was 0.20 of time spent feeding and browse intake was 0.62 of total DM intake. This was because the herbaceous vegetation was sparse and dry and, consequently, time-consuming to forage. In contrast, browse was still green and abundant and much easier to forage. Thus, for both small ruminants, the intake of herbaceous vegetation was higher than browse in the rainy season but, at one point in the dry season, these intakes were reversed. Furthermore, browse selection increased from the rainy to the dry season in both small ruminants and was always higher in goats than in sheep.


47

Laboratory study Mean crude protein (CP) concentration of the six fodder species was 140

g/kg DM with a range of 90 to 189 g/kg DM; concentrations of the halophytic shrubs were higher than the leguminous plants. Ash concentration ranged widely between 97 and 280 g/kg DM with the halophytic shrubs higher than the leguminous plants. Condensed tannins (CT) also had a wide range of values, 2 to 113 g/kg DM, with the leguminous plants higher than the halophytic shrubs. IVME yield averaged 4.84 kJ/g DM; Acacia saligna had the highest yield at 5.30 kJ/g DM and Cassia sturtii the lowest yield at 4.22 kJ/g DM. Oxalate concentration was higher in the Atriplex shrubs than in the Acaciatrees and Cassia sturtii. Gross energy yields of the six plants averaged 16.3 ± 2.1 kJ/g DM.

Total dry matter intakes (DMIs) of the fodders during the 15-min cafeteria trial were similar between sheep (95.6±10.1 g) and goats (92.6±17.8 g), as were mass specific intakes (2.33±0.15 g/kg and 2.54±0.49 g/kg, respectively). The two Acacia species comprised more than 70% and 86% of DMI in sheep and goats, respectively. The other 4 fodder species, Cassia sturtii, Atriplexcanescens, Atriplexhalimus andAtriplexnummulariaeach comprised less than 10% of DMI in both species.

The Euclidean distances of Jacobs' selectivity index allowed the comparison in the overall pattern of fodder selection between the two small ruminants. In general, fodder selection tended to be positively correlated between sheep and goats (Mantel test: n = 15; SSx = 19.34; SSy = 20.35; SPxy = 13.67; r

2 =

0.48; P = 0.071). A close examination of the scatter plot, however, revealed that the overall linear relationship failed to show an interesting point that within an intermediate range of Euclidean distances of Jacobs' selectivity index (D) in sheep, the correlation with that of goats was in fact negative. In other words, when selection among fodders differed moderately for sheep, goats showed a much higher and negative selective pattern. The regression equation without the intermediate points was Y = 0.46 + 0.84 X (n = 10; r

2 = 0.98) and for only the

intermediate points was Y = 13.70 – 5.36 X (n = 5; r2 = 0.70).

Dietary ratio (DR) differed significantly among fodder species but was similar for the same fodder when compared between sheep and goats. Dietary ratio of Acacia saligna was higher in goats than in sheep and was higher than that ofAcacia salicina for both sheep and goats.According to Jacobs' selectivity index, Acacia saligna was the most preferred species in both sheep and goats and showed positive preference values, while Acacia salicina showed slight positive preference in sheep but no preference in goats. The other 4 fodder species showed negative preference values by both sheep and goats.

The trees and shrubs examined in this study have been planted in the Negev desert as possible fodder for sheep and goats. These six plants are all well-adapted to desert conditions and, therefore, results have wide applications. In general, intake of these plants by small ruminants has been low, mainly due to the high tannin concentration in the Acacia spp. (11, 13) and Cassia sturtii and the high


48

salt and oxalate concentrations in the Atriplex spp. (1, 7). All the plant species have relatively high CP concentrations, ranging between 90 and 189 g/kg DM, which are levels above those of low quality fodder such as straw. However, at least the Atriplex spp. contain high concentrations of non-protein nitrogen such as glycine, betaine and proline (26), which can amount to 60% of the CP concentration (6). These compounds can be used to synthesize microbial proteins when a highly degradable energy source (carbohydrates) is available. However, this is not the case with Atriplex spp. and, as a result, the CP nitrogen is poorly used and much is excreted in the urine (19). In addition, sheep and goats consuming a diet of only Acacia saligna or Acacia salicina lose body mass and are in negative nitrogen balance (12, 18). These small ruminants excrete large amounts of nitrogen, most likely due to the nitrogen – energy imbalance and defecate much of the nitrogen complexed with tannins (46). Consequently, CP concentrations of a plant should be judged with caution when the diet is deficient in carbohydrate or is high in tannin concentration.

Fodder selection In general, it is believed that herbivores do not graze at random but have

marked food preferences and that their feed choices can be attributed to two main factors, namely, the nutritional and toxic contents of the plants (43). However, there is often a trade-off between these two traits and, consequently, feed selection results thus far have been equivocal. A number of studies have reported that selection was related to these two traits. For example, sheep grazing in the Negev desert selected the fine fraction available with a higher nutritive value (15). Grazing kudus selected a diet of higher digestible dry matter and CP but lower phenolics than the mean levels occurring in available plants (34). When offered a choice, mule deer and black-tailed deer selected plantforages containing the highest digestible dry matter and lowest non-tannin phenolics. Non-tannin phenolics such as glycosides inhibit microbial action in the gastrointestinal tract and, consequently, reduce digestibility (21). However, these deer preferred low energy plants when the forage contained high levels of non-tannin phenolics, but tannins had little effect on their feed choice (30). Browse selection by Karakul sheep in the desert rangelands of Kazakhstan was related to total phenolic concentration but not to ME yield nor to CP and fibre concentrations of the plants (14). Less of a relation to these traits was found in other studies. For example, in a study of 22 tropical browse species, three of the highest ranked species were not eaten (10). Furthermore, in a study of nutritive characteristics of six Mediterranean fodder shrubs, preferences by sheep and goat were neither related to CT nor to in vitro gas production (ME yield). Shrub intake was related to in vitro dry matter digestibility in sheep, but this was not the case in goats (5).

In the cafeteria trial in this study, DMI of the feeds was similar between the sheep and goats, as was the ranking of intakes of the feeds. In a cafeteria study of six Mediterranean shrubs in which the feeds were offered throughout the day,


49

Rogosic et al. (39) also found that the ranking of intakes was similar between the two small ruminants, but that the intake of the goats was higher than that of the sheep. Acacia saligna was preferred by both sheep and goats, followed by Acacia salicina, although, of the six fodder species, the Acacia trees had the highest CT concentrations, which generally deters intake. Interestingly, there was the same ranking of feed intakes between the sheep and goats, although their dietary preferences differ substantially (3) and goats could handle tannins better than sheep (16). This similar ranking may have been due to the low fodder intakes and, therefore, total tannins intakes were actually low. Furthermore, the Acaciaphylodes had the highest IVME energy yield which may have influenced their intakes. Ash and oxalate concentrations were relatively low in the Acacia trees and this, too, may have contributed to their intakes and/or the high ash and oxalate concentrations resulted in "negative" selection against the Atriplex spp.

Sheep browsing Atriplexnummularia, Atriplexcanescens and Cassia sturtii in the Negev Desert first defoliated Cassia sturtii completely before browsing the Atriplex spp. (7, Benjamin, personal observations). Furthermore, Cassia sturtii recovered better after browsing than did Atriplexnummularia and Atriplexcanescens. It is possible that there are differences in feed selection between free-grazing sheep and goats consuming fresh shrubs and caged animals offered air-dried leaves of the same shrubs and between these small ruminants offered the feeds for 15 minutes and offered the feeds throughout the day, as was done by Rogosic et al. (39).

Conclusions

In the field, the foraging pattern was similar between sheep and goats and

only towards the end, that is when forage became dry and sparse, did patterns differ significantly between these two ruminants. Herbaceous vegetation that emerged after winter rains were preferred by both sheep and goats, and were consumed exclusively for the first 2 weeks (W2 and W3). Differences in foraging pattern and in dietary selection between sheep and goats became apparent only when herbaceous plants dried out and availability decreased substantially.

In the laboratory cafeteria trials, the ranking of intakes of the six plants was similar for the two small ruminants. Intake of Acaciasaligna, although highest in CT concentration, was highest for both sheep and goats. The similar pattern in intake is of interest as goats can handle tannins better than sheep. With low dietary intakes, the high CT concentrations in Acacia spp. did not deter intakes in either small ruminant. In spite of the low intakes, these fodders could prove to be a valuable CP source in supplementary feed.


50

Acknowledgements

We thank Abdullah Abou-Rachbah for technical help, Mussa Abu-Kaf for allowing us to observe his flock and his hospitality and Ali el-Assem for information on sheep and goat husbandry.

References

1. Abu-Zanat, M.M., Al-Hassanat, F.M., Alawi, M., Ruyle, G.B., Oxalate and tannins assessment in Atriplexhalimus L. and A. nummularia L. Journal of Range Managements, 2003, 56, 370-374.

2. Alicacta, M.L., Amato, G., Bonnanno, A., Leto, G., In vitro digestibility and nutritive value of Atriplexhalimus alone and mixed with wheatstraw. Journal of Agricultural Science, Cambridge, 2002,139, 130–142.

3. Animut, G., Goetsch, A.L., Co-grazing of sheep and goats: Benefits and constraints.Small Ruminants Research, 2008, 77, 127-145.

4. Becker, K.,Lohrmann, J., Feed selection by goats on tropical semi-humid rangeland. Small Ruminants Research, 1992, 8, 285-298.

5. Ben Salem, H., Nefzaoui, A., Ben Salem, L., Sheep and goat preferences for Mediterranean fodder shrubs. Relationship with the nutritive characteristics. In: Sheep and goat nutrition: intake, digestion, quality of products and rangelands.Zarazoga: CIHEAM-AAMZ, 2000, pp. 155-159.

6. Benjamin, R.W., Sheep production from agricultural systems. In: Alberda, T., de Wit, K., Seligman, N.G. and van Keulen, H. (eds.), Foods from dry lands. Kluwer Academic Publishers, Holland, 1992, pp. 83-100.

7. Benjamin, R.W., Lavie, Y, Forti, M., Barkai, D., Yonatan, R. Hefetz, Y., Annual regrowth and edible biomass of two species of Atriplex and of Cassiasturtii after browsing.Journal of Arid Environments, 1995, 29, 63-84.

8. Celaya, R., Oliván, M., Ferreira, L. M. M., Martinez, A., Garcia, U., Osoro, K., Comparison of grazing behaviour, dietary overlap and performance in non-lactating domestic ruminants on marginal heathland areas.Livestock Science, 2007, 106, 271-281.

9. Cissé, M., Ly, I., Nianogo, A. J., Sane, I., Sawadogo, J. G., N'Diaye, M., Awad, C., Fall, Y., Grazing behaviour and milk yield of Senegalese Sahel goat. Small Ruminant Research, 2002, 43, 85-95.

10. Conklin, N.L., McDowell, R.E. Van Soest, P.J., Ranking twenty-two tropical browse species from Guanacaste, Costa Rica.Turrialba, 1991, 41, 615-625.

11. Degen, A.A., Becker, K., Makkar, H. P. S., Borowy, N., Acacia saligna as fodder tree for desert livestock and the interactions of its tannins with fiber fractions.Journal of Science, Food and Agriculture, 1995, 68, 65-71.


51

12. Degen, A.A., Blanke, A., Becker, K., Kam, M., Benjamin, R.W., Makkar, H.P.S., The nutritive value of Acacia saligna and Acacia salicina for goats and sheep, Animal Science, 1997, 64, 253-259.

13. Degen, A.A., Benjamin, R.W., Mishorr, T., Kam, M., Becker, K., Makkar, H.P.S., Schwartz, H.J., Acacia saligna as a supplementary feed for grazing desert sheep and goats.Journal of Agricultural Science, Cambridge, 2000, 135, 77-84.

14. Degen, A.A., Benjamin, R.W., Abdraimov, S.A., Sarbasov, T.I., Browse selection by Karakul desert sheep in relation to plant composition and estimated metabolizable energy content. Journal of Agricultural Science, Cambridge, 2002, 139, 353-358.

15. deRidder, N, Benjamin, R.W. van Keulen, H., Forage selection and performance of sheep grazing a dry annual range. Journal of Arid Environments, 1986, 10, 39-51.

16. Distel, R.A., Provenza, F.D., Experience early in life affects voluntary intake of blackbrush by goats. Journal of Chemical Ecology, 1991, 17, 431-450.

17. Dynes, R.A.,Schlink, A.C., Livestock potential of Australian species of Acacia.Conservation Science Western Australia Journal, 2002, 4, 117-124.

18. El-Meccawi, S., Kam, M., Brosh, A., Degen, A.A., Heat production and energy balance of sheep and goats fed sole diets of Acacia saligna and Medicago sativa. Small Ruminants Research, 2008, 75, 199-203.

19. Hassan, N.I., Abd El Aziz, H.M., The effect of barley supplementation on the nutritive value of saltbush (Atriplexnummularia).World Review of Animal Production, 1979, 15, 47-52.

20. Hofmann, R.R., Evolutionary steps of ecophysiological adaptation and diversification of ruminants: a comparative view of their digestive system. Oecologia, 1989, 78, 443-457.

21. Iason, G.R., Murray, A.H., The energy costs of ingestion of naturally occurring nontannin plant phenolics by sheep. Physiological Zoology, 1996, 69, 532-546.

22. Jacobs, J., Quantitative measurement of food selection.A modification of the forage ratio and Ivlev's electivity index.Oecologia, 1974, 14, 413-417.

23. Kam, M., Khokhlova, I.S., Degen, A.A., Granivory and plant selection by desert gerbils of different body size.Ecology, 1997, 78, 2218-2229.

24. Kendall, M.G., Tests of randomness. In: Time series. Hafner, NY, 1976, pp. 21-28.

25. Le Houérou, H.N., Planting and management methods for browse trees and shrubs. In: Le Houérou, H.N. (ed.). Browse in Africa, the current state of knowledge. UNESCO, Paris, 1980, pp. 351-359.

26. Le Houérou, H.N., Forage halophytes and salt-tolerant fodder crops in the Mediterranean basin. In: Squires, V.R. and Ayoub, A.T. (eds.). Halophytes


52

as a resource for livestock and for rehabilitation of degraded lands. Kluwer Academic Publishers, Dordrecht, 1992, pp. 123-137.

27. Levinson, E., Yogev, H., Statistical Yearbook of the Negev Bedouin.Beer Sheva, Israel: Negev Development Authority and Ben Gurion University of the Negev, 2004.

28. Mantel, N.A., Valand, R.S., A technique for non-parametric multivariate analysis.Biometrics, 1970, 26, 547-558.

29. McArthur, C. Hagerman, A.E., Robbins, C.T., Physiological strategies of mammalian herbivores against plant defenses. In:Palo,T.and Robbins, C.T. (eds), Plant Defenses against Mammalian Herbivory,Boca Raton, Florida, USA: CRC Press, 1991, pp. 103-114.

30. McArthur, C., Robbins, C. T., Hageman, A. E., Hanley, T. A., Diet selection by ruminant generalist browser in relation to plant chemistry.Canadian Journal of Zoology, 1993, 71, 2236-2243.

31. Murdiati, T.B., McSweeney, C.S., Lowry, J.B., Metabolism in sheep of gallic acid, tannic acid and hydrolyzable tannin from Terminalia oblongata.AustralianJournal of Agricultural Research, 1992, 43, 1307-1319.

32. Ngwa, A.T., Pone, D.K., Mafeni, J.M., Feed selection and dietary preferences of forage by small ruminants grazing natural pastures in the Sahelian zone of Cameroon. Animal Feed Science and Technology, 2000, 88, 253-266.

33. Omphile, U. J., Aganga, A. A., Tshireletso, K., Nkele, R., Foraging strategies of sheep and goats under semi-intensive management in Botswana.South African Journal of Animal Science, 2004, 34 (Supplement 1), 120-122,

34. Owen-Smith, N., Cooper, S.M., Nutritional ecology of a browserruminant, the kudu, through the seasonal cycle.Journal of Zoology, London, 1989, 219, 29–43.

35. Pandey, L.N., Kam, M., Pandey, S.B., Upreti, C.R., Osti, N.P., Degen, A.A., Indigenous knowledge of fodder tree selectivity by local goats in the mid-hills of Nepal.Journal of Enterprising Communities: People and Places in the Global Economy, 2009, 3, 241-255.

36. Papachristou, T.G., Foraging behaviour of goats and sheep on Mediterranean kermes oak shrublands.Small Ruminant Research, 1997, 24, 85-93.

37. Pasiecznik, N.M., Vera-Cruz, M.T., Harris, P.J.C., Thecurrent status of Atriplexonthe Cape Verde Islands. Journal of Arid Environments, 1996, 34, 507–519.

38. Robbins, C.T., Hanley, T.A., Hagerman, A.E., Hjeljord, O., Baker, D.L., Schwartz, C.C., Mautz, W.W., Role of tannins in defending plants against ruminants: Reduction in protein availability. Ecology, 1987, 68, 98-107.


53

39. Rogosic, J., Pfister, J.A., Provenza, F.D., Grbesa, D., Sheep and goat preference for nutritional value of Mediterranean maquis shrubs.Small Ruminants Research, 2006, 64, 169-179.

40. Sanon, H.O., Kaboré-Zoungrana, C., Ledin, I., Behaviour of goats, sheep and cattle and their selection of browse speciedon natural pasture in a Sahelian area. Small Ruminant Research, 2007, 67, 64-74.

41. Seim, V., Holand, O., Factors Influencing Grazing Behaviour of Small and Large Ruminants at High Pastures in BashoValley, Northern Pakistan. Aas, Norway: NorwegianUniversity of Life Sciences, 1999. Available online at: http://www.umb.no/statisk/akrsp/06_publications_and_presentations/01_articles_and_briefs/6_factors_influencing_grazing.pdf (verified 4 Dec 2011).

42. Shetaewi, M.M., Abdel-Samee, A.M., Bakr, E.A., Reproductive performance and milk production of Damascus goats fed Acacia shrubs or berseem clover hay in North Sinai, Egypt. Tropical Animal Health and Production, 2001, 33, 67-79.

43. Torregrossa, A-M., Dearing, M.D., Nutritional toxicology of mammals: regulated intake of plant secondary compounds. Functional Ecology, 2009, 23, 48-56.

44. Tadmor, N.H., Brieghet, A., Noy-Meir, I, Benjamin, R.W., Eyal, E., An evaluation of the calibrated weight-estimate method for measuring production in annual vegetation.Journal of Range Management, 1975, 28, 65-69.

45. Topps, J.H., Potential, composition and use of legume shrubs and trees as fodders for livestock in the tropics.Journal of Agricultural Science, Cambridge, 1992, 118, 1-8.

46. Unruh Snyder, L.J., Luginbuhl, J-M., Mueller, J.P., Conrad, A.P., Turnrt, K.E., Intake, digestibility and nitrogen utilization of Robiniapseudoacacia foliage fed to growing goat wethers. Small Ruminant Research, 2007, 71, 179-193.

47. Ventura, M.R., Castanon, J.I.R., Pieltain, M.C., Flores, M.P., Nutritive value of forage shrubs: Bituminariabituminosa, Rumexlunaria, Acacia salicina, Cassia sturtiiand Adenocorpusfoliosus. Small Ruminant Research, 52, 2004, 13-18.

48. Wahed, R.A., Owen, E., Comparison of sheep and goats under stall-feeding conditions: Roughage intake and selection. Animal Production, 1986, 42, 89-95.


54

THE MORPHOLOGY OF THE VERTEBRAL COLUMN IN BENGAL TIGER (PANTHERA TIGRIS TIGRIS) – CASE STUDY

B. GEORGESCU

1, G. PREDOI

1, C. BELU

1, I.DUMITRESCU

1, PETRONELA

ROȘU1, ȘTEFANIA MARIANA RAITA

1, LETIȚIA PURDOIU

1, OANA-

MĂRGĂRITA GHIMPEȚEANU1, FLORICA BĂRBUCEANU

2

1Department of Anatomy, Faculty of Veterinary Medicine, University of Agronomical

Sciences and Veterinary Medicine, Bucharest, Romania 2Institute for Diagnosis and Animal Health, Bucharest, Romania


Summary

In order to describe the anatomical configuration of these species, were used bones from a dead body of a Bengal tiger male (Panthera tigris tigris), which was donated for teaching purposes from N & Variety Circus GLOBUS Bucharest. This exemplar died at age of 9 years. Being a protected species we have found necessary to describe its morphology, due to the fact that it can be useful to the veterinarians and biologist from zoo, parks and protected areas. It can also be helpful for customs authorities, given that it is possible to discover poached and illegally transited specimens or bones traffic. The tiger is a strictly protected species and included of the Red List of IUCN. The pieces were obtained after removal of soft tissue and subjected to maceration process. After using this process, the bones were washed and dried. Bones were measured and described in accordance with Nomina Anatomica Veterinaria – 2005. The results were compared with the ones existing for the jaguar (Panthera onca). The atlas, the first cervical vertebra, shows a sharp reduction

of the body and is represented by a vertebral arch, showing the ventral tuber reduced spine aspect. The axis, the second cervical vertebra, presents the face elongated dorsal spinous process cranio-caudal developed with the free edge slightly thickened and finished with a clear caudal tubercle. The body of the other cervical vertebras decreases from the third vertebra to the seventh vertebra. The tiger has 13 thoracic vertebrae. The seven lumbar vertebrae have a developed body, flattened dorso-ventral increasing cranio-caudal direction width. Sacral vertebrae, 3, are welded to each other to form the sacrum. The tiger has 22 caudal vertebrae. All studied vertebrae have the general features presented in cats. In comparison with the jaguar, tiger‟s vertebrae are significantly bigger. We consider that the differences can be one of the criteria of establishing bones origin when required.

Key words: Bengal tiger, vertebral column, bones, measurement

In order to describe the anatomical configuration there were used bones from a specimen of Bengal tiger male (Panthera tigris tigris), male named Amur, which was donated for teaching purposes by N & Variety Circus GLOBUS Bucharest. This exemplar died at age of 9. Considering it being a protected species we have found necessary to describe its morphology, due to the fact that it can be useful to the veterinarians and biologists at zoological garden, parks and protected areas. It can also be helpful for customs authorities, given that it is possible to


55

discover poached and illegally transited specimens or bones trafficking. The tiger is a strictly protected species and included on the Red List of IUCN.

The tiger (Panthera tigris) is the largest representative of the felidae family, a carnivore whose historical habitat covered the Russian Far Eastern territory, the south-eastern Iran, Sonde islands, northern China, Sumatra island, Java, Bali, India, Siberia, peninsula of Malacca, Kazakhstan, area that decreased over the years. It inhabits humid areas of tropical forests, barren rocky regions, taiga, but it is not found in mountainous areas on high altitudes. The decreasing of habitat occurred due to human population growth in these areas, leading to deforestation on vast territories, which led to the decrease in the number of exemplars on the one hand, and on the other hand even to the disappearance of some subspecies: the Caspian tiger (Panthera tigris virgata), disappeared in the early 50s, the Bali tiger (Panthera tigris balica) disappeared in 1937, Java tiger (Panthera tigris sondaica) disappeared in the 70s of last century. The tiger (Panthera tigris) reaches 3 meters in length and the body weight of 250-300 kg (with variations depending on subspecies, the largest being the Siberian/ Amur subspecies) with a lifespan of 10-15 years in the wild. The tiger is a highly endangered species, brought to the brink of extinction. In this paper we describe the morphology of the axial skeleton of the Bengal tiger (Panthera tigris tigris). The undertaken research in developing this work is motivated by the usefulness of knowing the axial skeleton morphology of the tiger, for veterinarians dealing with growth and ensuring the health of these felines in zoos, and also parks and protected areas. The tiger is one of the feline species protected in their natural habitat, which were introduced in Annex 1 of CITES (Convention on International Trade in Endangered Species of Wild Fauna and Flora, 1973) (11, 12, 14, 15, 16, 17).

The research took into account obtaining morphological details of the tiger‟s axial skeleton, trying to create a suggestive iconographic material for easier understanding of these details.

We must point out that the measurements were performed on a captive exemplar, knowing that, in general, due to the "cage effect" captive specimens are slightly lower dimensionally than those of wild (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 13).


To describe the morphology of the axial skeleton, there were used bones

from a Bengal tiger male corpse (Panthera tigris tigris), 9 years aged, named Amur, donated by N & Variete Globus Circus for teaching purposes. The vertebrae were obtained after removal of soft tissue, after that subjected to controlled maceration process, washed and degreased with ordinary detergents. The last operation was 10% hydrogen peroxide whitening of bones. Costal cartilages and sternum were manually cleaned. Measurements were performed and there were photographed the most interesting aspects. Description, identification and homologation were performed according to N.A.V. 2005 (13).


56


The spinal column is the sagittal axis of the skeleton, consisting of successive articulation of short bones, called vertebrae. The vertebrae in their sequence define the spinal or vertebral canal that houses and protects the spinal cord and spinal nerves. Regarding morphofunctional characteristics of the vertebrae, vertebral column is divided into five regions: cervical, thoracic or dorsal, lumbar, sacral and coccygeal (1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 13).

For the studied tiger the spine consists of 52 vertebrae, arranged as follows: 7 cervical, 13 thoracic vertebrae, seven lumbar vertebrae, three sacral vertebrae and 22 coccygeal vertebrae.

The atlas has a different shape from the rest of the cervical vertebrae, showing a sharp reduction in body, which is represented by a vertebral arch, which has a reduced ventral tubercle, with spine appearance (fig. 1 and 2).

Fig. 1. First cervical vertebra (atlas) of a Bengal tiger (Panthera tigris tigris) – dorsal side (original)

1 – Wing of the atlas (alae atlantis); 2 – Dorsal tubercle (tuberculum dorsale); 3 – Alar notch (incisura alaris); 4 – Lateral vertebral foramen (foramen vertebrale

laterale)

The dorsal side of the body has an extensive articulation facet for the odontoid process of the axis articulation, which has a length of 1.8 cm and a width of 2.1 cm. The cranial side of the atlas presents articular facets represented by two deep glenoid cavities, separated by a rough surface with a length of 0.5 cm and a width of 0.65 cm, for the articulation with the two occipital condyles. In the rear arch it is observed a reduced dorsal tubercle, with a diameter of 0.8 cm, as a rudiment of the spinous process. Caudal side shows slightly lateral-medial concave articular facets, with a length of 1.8 cm and a width of 2.1 cm, designed for articulating with joint cranial facets of the axis.


57

Fig. 2. First cervical vertebra (atlas) of a Bengal tiger (Panthera tigris tigris) – caudal side (original)

1 – Wing of the atlas (alae atlantis); 2 – Transverse foramen (foramen transversarium); 3 – Caudal articular fovea (facies articularis caudalis); 4 – Ventral

tubercle (tuberculum ventrale)

Transverse processes are transformed in the wings of the atlas, with bony

blades aspect, presenting on their surface numerous muscle insertion lines and their edge appears thickened. Atlas wing shows a length of 7.1 cm and a width of 2.6 cm. On the ventral side of the atlas wings there is a small depression called Atlas fossa. The alar foramen is transformed in alar notch, base of 0.4 cm and 1.3 cm in depth. Lateral vertebral foramen is located medial to alar notch, with the large axis with a diameter of 1.5 cm, and 0.5 cm in diameter for the small axis, communicating with alar notch by a short alar canal. On the caudal side of the atlas, on the caudal edge, on both sides of the joint facets there can be seen transverse foramina with a diameter of 0.6 cm. Transverse foramen opens to 1.6 cm of the alar notch top, on the ventral side of the atlas, the opening having a diameter of 0.4 cm.

The axis is the second cervical vertebra, characterized by an elongated spinous process cranial-caudally developed with the free edge slightly thickened and finished with a prominent caudal tubercle. The spinous process has a length of 9.7 cm, and the width in the middle third is 2.3 cm. (Fig. 3). The axis body is elongated, dorsal-ventral flattened, solid, with a length of 6.7 cm, showing a cranial side on which it is a cylindroid odontoid process, with a length of 3.75 cm, flanked on its sides by cranial articular facets, convex in both directions and arranged slightly obliquely, designed for articulation with caudal side of the atlas. The caudal side of the axis shows a joint facet easily excavated. The ventral side of the axis


58

body in the median plane shows a faintly highlighted spinal ventral ridge. From the lateral sides of the body detach simple transverse processes, directed caudally, highly exceeding the caudal articular facet, showing at the bottom transverse foramen whose diameter is 0.9 cm. Cranial articular processes are not present, and the caudal ones are separated of spinous process by a deep vertebra caudal notch, of approximately 2.3 cm. Cranial vertebral notch is well evidenced, with a depth of 1.4 cm.

Fig. 3. – Second cervical vertebra (axis) of a Bengal tiger (Panthera tigris tigris) – lateral aspect (original)

1 – Dens (dens); 2 – Spinous process (processus spinosus); 3 – Caudal articular process (processus articularis caudalis); 4 – Transverse foramen (foramen

transversarium); 5 – Cranial articular process (facies articularis cranialis); 6 – Tranverse process (processus transversus); 7 – Cranial vertebral notch (incisura

vertebralis cranialis); 8 – Caudal vertebral notch (incisura vertebralis caudalis)

Cervical vertebrae III - VII. Cervical vertebrae III, IV and V are characteristic type of cervical vertebra. The body of cervical vertebrae decreases in cranial-caudal direction from the third vertebra with a length of 4.3 cm, the seventh vertebra with a length of 4 cm. Cranial and caudal articular facets tend to be amphicoelic. Vertebral arch is well highlighted, the spinous process increases in the cranial-caudal direction (from a height of 2.35 cm at the third vertebra, 6 cm at the VII). (Fig. 4)


59

Fig. 4. Cervical vertebrae III - VII of a Bengal tiger (Panthera tigris tigris) – dorsal aspect (original)

1 – Spinous process (processus spinosus); 2 - Caudal articular process (processus articularis caudalis); 3 - Cranial articular process (processus articularis cranialis); 4

– Transverse process (processus transversus).

Cranial articular processes have planiform and medial dorsal oriented facets, while caudal articular processes, also with planiform facets, have ventral-lateral orientation. The transverse processes on the sides, have a ventral orientation, being bicuspid, at the vertebrae III - VI, presenting blade aspect ventral cusp from the third cervical vertebra and ending with the vertebrae V and VI where it is the most developed, giving trough aspect to the ventral side of the cervical region. Ventral cusp length at the sixth cervical vertebra is 5.7 cm, the most developed. The blades of the ventral cusps present on the lateral side a reduced excavation. The base of the transverse processes is perforated by a transverse foramen. On the cranial side of the sixth cervical vertebra, transverse foramen has a diameter of 0.9 cm and on the caudal side of vertebra it has a diameter of 0.6 cm. On the ventral side of the vertebral body it is observed a reduced ventral vertebral crest. The seventh cervical vertebra is characterized by a reduction of the body (4 cm), unicuspid transverse processes, and without a transverse foramen, very high spinous process, and on both parts of the caudal side of the body there are observed caudal costal fovea for articulation with the head of the rib.

Bengal tiger thoracic vertebrae, 13 in number, form the thoracic cage along with the ribs and sternum (Fig. 5). The body of thoracic vertebrae increases in the cranial-caudal direction, the first vertebra having a body length of 3.5 cm, while the body of the last thoracic vertebra, the XIII

th, has a length of 4.6 cm. The

body of these vertebrae is flattened dorsal-ventral, and there is no spinal ventral ridge on the ventral side. On the lateral parts of the cranial and caudal end facets


60

there are arranged costal fovea. The last thoracic vertebra doesn‟t have costal fovea. Articular facets of the terminal sides are amphicoelic. Spinous processes are widened at the base, tapering towards the free end, ending with a small tubercle. Spinous processes height decreases in the cranial-caudal direction so the spinous process of the first thoracic vertebra has a height of 8.2 cm, while the spinous process of the XIII

th vertebra is only 4.1 cm. The caudal edge of the spinous

process is slightly thickened, while the cranial edge is thin, concave and slightly sharp.

Fig. 5. The second thoracic vertebra of a Bengal tiger (Panthera tigris tigris) – cranial-lateral aspect (original)

1 – Articular facet (facies articularis transversalis); 2 – Cranial costal facet (fovea costalis cranialis); 3 – Cranial articular process (prosessus articularis cranialis); 4 –

Spinous process (processus spinosus).

Spinous processes of the first ten thoracic vertebrae have a caudal orientation, and the last two vertebrae have a spinous process with a slightly cranial orientation. Spinous process of vertebra XI has vertical orientation. Transverse processes are short, latero-dorsal disposed, showing a costal-transverse facet on the free end, slightly concave to the first vertebrae, becoming flat in the middle of the series, and at the last three vertebrae being faded, designed for articulation with rib tuberosity. On the dorsal side, for the transverse


61

process, it is observed a mammillar tubercle. The articular processes, cranial and caudal, located at the base of the vertebral arch blades, have flat articular facets having different orientation to the cranial ones, dorsal-lateral, and the caudal ones, ventral-medial. Caudal vertebral notches are well highlighted being deep and wide, and the cranial ones are very small. At the end of the thoracic vertebrae series there are present reduced accessory processes.

The lumbar vertebrae, 7 in number, form the anatomical basis of the abdominal cavity arch. For the Bengal tiger, lumbar vertebrae body is well developed, dorsal-ventrally flattened, increasing in width in the cranio-caudal direction. The ending cranial and caudal facets are amphicoelic. The ventral side of the body is deprived of spinal ventral ridge. Spinous processes are wide, reduced in height, and cranially directed (Fig. 6). Transverse processes are highly developed, with a latero-ventral-cranial orientation, increasing in length from the first lumbar vertebra - 1.9 cm, to the last vertebra - 6.1 cm. At the last lumbar vertebrae, transverse process presents sharp free edge, directed cranially at the last 3 - 4 vertebrae.

Fig. 6. Lumbar spine of a Bengal tiger (Panthera tigris tigris) – lateral aspect (original)

1 – Spinous process (processus spinosus); 2 – Accessory process (processus accessorius); 3 – Mamilloarticular process (processus mamilo-articularis); 4 –

Caudal articular process (processus articularis caudalis); 5 – Transverse process (processus transversus)

Cranial articular or mammillo-articular processes are well defined, very

high, reaching half the height of the spinous process, with relatively flat articular facets, medially arranged. Caudal articular processes are evident, with flat articular facets and arranged laterally. Accessory processes are present, decreasing caudally, at the first lumbar vertebra with a length of 3.4 cm, and at the sixth lumbar


62

vertebra with just 1.6 cm. For the last lumbar vertebra accessory processes are not present.

Sacral vertebrae, 3 in number, stand as a single piece, forming sacrum bone. Sacrum is partially the anatomical pelvic cavity vault, by articulating with the two iliac blades. The connection at the level of the vertebral bodies is complete, there are no large interarch spaces (Fig. 7). With relatively trapezoidal shape, cranio-caudal axis relatively straight, with a length of 10.1 cm, sacrum is dorso-ventrally flattened, showing a cranial oriented base, caudally oriented crest, two edges and two facets. Sacrum base is the cranial facet of the first sacral vertebra, showing a relatively flat articular facet through which it articulates with the articular caudal facet of the last lumbar vertebra. Ventral facet of the first sacral vertebra is called the promontory. Transverse processes of the first sacral vertebra are widened, being transformed into wings of the sacrum, with a length of 6.3 cm and a height of 5.1 cm, cranially exceeding the articular facet of the first sacral vertebra. On the wings of the sacrum there are auricular facets, of relatively elongated shape, for articulation with the medial iliac blades. Cranial articular processes emerge from the wings of the sacrum, showing articular facets slightly excavated and dorsomedially directed.

Fig. 7. Sacrum of a Bengal tiger (Panthera tigris tigris) – dorsal aspect (original) 1 – Spinous process (processus spinosus); 2 – Cranial articular tubercle

(processus articularis cranialis); 3 – Dorsal sacral foramen (foramina suprasacralis); 4 – Caudal articular process (processus articularis caudalis); 5 –

Transversal process (processus transversarius)


63

On the dorsal facet of the sacrum it is observed the median sacral crest made of thorny well individualized processes, and the small intermediate sacral crest, consisting of two distinct tubercles, latero-dorsally directed, 0.7 cm long. On their lateral side, we observe two super-sacral foramina, well individualized. The super-sacral foramen cranially disposed has a diameter of 0.75 cm, while the super-sacral foramen caudally disposed has a diameter of 0.8 cm. Transverse processes are individualized only on the last sacral vertebra having a caudo-lateral orientation, and a length of 2.1 cm, beyond the crest of the sacrum. The ventral side of the sacrum, relatively straight, has two under-sacral foramina, the cranially oriented one with a larger diameter, of 1.1 cm, and the caudal one only 0.8 cm.

Fig. 8. Caudal (coccygeal) vertebrae of a Bengal tiger (Panthera tigris tigris) – (original)

Coccygeal vertebrae form the anatomical base of the tail. Their number

varies not only from one species to another, but even from one individual to another within the species. Thus, for the studied tiger, the number of coccygeal vertebrae is 22. (Fig. 8). At the first 7 vertebrae, the vertebral arch is reduced and for the rest of vertebrae it doesn‟t exist. For the first seven vertebrae it can be see all the specific elements of a vertebra. Cranial and caudal articular facets of the body are convex, belonging to amphicirtian type, articulating between them through intervertebral biconvex and thick discs. Coccygeal vertebrae body length increases from the first vertebra (3.2 cm) to about half of the series (vertebra XI - 6.1 cm) and then begins to decrease until the last one (1.5 cm). On the ventral side of the coccygeal vertebrae, IV and V, we observe two reduced hemal tubercles.


64

Conclusions

The atlas, the first cervical vertebra, for the Bengal tiger (Panthera tigris tigris) shows a pronounced reduction of the body, and is represented by a vertebral arch, showing on the ventral facet a reduced tubercle with spine aspect.

The axis, the second cervical vertebra, presents on the dorsal facet a cranio-caudally developed elongated spinous process, with the free edge slightly thickened and finished with a clear caudal tubercle.

The cervical vertebrae III-VII. The body of the cervical vertebrae decreases in the cranial-caudal direction from the third vertebra with a length of 4.3 cm, to the seventh vertebra with a length of 4 cm. Cranial and caudal articular facets tend to being amphicoelic. The spinous process increases in the cranio-caudal direction, with a height of 2.35 cm at the third vertebra, and 6 cm at the VII

th. Transverse

processes are bicuspid showing blade aspect ventral cusp, giving trough aspect to the ventral side of the cervical region. The length of ventral cusp at the VIth cervical vertebra is 5.7 cm, being the most developed. On the lateral side of the ventral cusps blades there is a reduced excavation.

The Bengal tiger has 13 thoracic vertebrae, whose body increases in cranio-caudal direction, the first vertebra having a body length of 3.5 cm, while the body of the last thoracic vertebra, XIII, has a length of 4.6 cm.

The spinous processes of the first ten thoracic vertebrae have a caudal orientation and the last two vertebrae have slightly cranial orientation. The spinous process of the XI

th vertebra has a vertical orientation.

The transverse processes are short, latero-dorsally arranged, showing at the free edge a costal-transverse facet, slightly concave to the first vertebrae, becoming flat in the middle of the series, and at the last three vertebrae being faded. On the dorsal side of the transverse process there is a mammillar tubercle. Caudal vertebral notches are well highlighted being deep and wide, and the cranial ones are very small. At the end of vertebrae series there are present reduced accessory processes.

The lumbar vertebrae, 7 in number, have developed body, dorso-ventrally flattened increasing in width in cranio-caudal direction. Cranial and caudal end facets are amphicoelic and ventral body facet lacks vertebral ventral crest.

The spinous processes are wide, reduced in height, and cranially oriented. Transverse processes are highly developed, have latero-ventral-cranial orientation, increasing in length from the first lumbar vertebra - 1.9 cm, to the last vertebra - 6.1 cm. At the last lumbar vertebrae the transverse process presents sharp free edge cranially oriented at the last 3 to 4 vertebrae.

The cranial articular or mammillo-articular processes are visible, very high, reaching half the height of the spinous process. Accessory processes are present, decreasing caudally, at the first lumbar vertebra with a length of 3.4 cm, and at the sixth with just 1.6 cm. For the last lumbar vertebra accessory processes are not present.


65

The sacral vertebrae, 3 in number, stand as a single piece, forming sacrum bone. The connection at the level of the vertebral bodies is complete, there are no large interarch spaces. Sacrum has a relatively trapezoidal shape, cranio-caudal axis relatively straight, with a length of 10.1 cm.

There are 22 coccygeal vertebrae at the Bengal tiger. At the first 7 vertebrae, the vertebral arch is reduced and for the rest of vertebrae it doesn‟t exist. For the first seven vertebrae it can be seen all the specific elements of a vertebra. Coccygeal vertebrae body length increases from the first vertebra, 3.2 cm, to about half of the series, the XI

th vertebra with 6.1 cm in length, and then

begins to decrease until the last one, with a length of 1.5 cm. On the ventral side of the coccygeal vertebrae, IV and V, we observe two reduced hemal tubercles.

References

1. Barone, R. Anatomie compare des mammiferes domestiques, Tome premier

– Osteologie. Imprimerie des Beaux – Arts S.A. – J. Tixier &Fils, Lyon, 1966. 2. Belu, C., Predoi, G., Georgescu, B., Dumitrescu, I., Șeicaru, A., Roșu, P.,

Oprea, A., Vișoiu, C. The morphology of the vertebral column skelleton in jaguar (Panthera onca). Lucrări Științifice – Universitatea de Științe Agricole a Banatului Timișoara, 46 (1), p. 18-22, 2013.

3. Coțofan, V., Palicica, R., Hrițcu, V., Enciu, V. Anatomia animalelor domestice, vol. I – Aparatul de susținere și mișcare. Orizonturi universitare, Timișoara. 1999.

4. Dornescu, G.T., Necrasov, O.C. Anatomia comparată a vertebratelor, Vol. I. Editura didactică şi pedagogică, Bucureşti, 1968.

5. Getty, R. The anatomy of the domestic animals, Vol. II, fifth edition. Saunders Company, Philadelphia, 1975.

6. Gheție, V., Hillebrand, A. Anatomia animalelor domestice, Vol. I, Aparatul locomotor. Editura Academiei Republicii Socialiste România, București, 1971.

7. Konig, H.E., Liebich, H.G. Veterinary Anatomy of Domestic Mammals. Schattauer GmbH, Stuttgart, 2004.

8. Paştea, E., Constantinescu, Gh., Mureşianu, E., Coţofan, V. Anatomia comparativă şi topografică a animalelor domestice, Ed. Didactică şi pedagogică, Bucureşti, 1978.

9. Predoi, G., Georgescu, B., Belu, C., Dumitrescu, I., Şeicaru, A., Roşu, P. Anatomia comparată a animalelor domestice. Osteologie, artrologie, miologie. Ceres, Bucureşti, 2011.

10. Sisson, S., Grossman, J.D. The Anatomy of the Domestic Animals, 4th edition. W.B. Saunders Company, Philadelphia, 1953.

11. Sunquist, M., Sunquist, F. Wild cats of the world. The University of Chicago Press, Chicago, 2002.


66

12. Turner, A. The Big Cats and their fossil relatives. Columbia University Press, N. Y., 1996.

13. *** Nomina Anatomica Veterinaria, fifth edition. Editorial Committee Hannover, Columbia, 2005.

14. *** http://biology.kenyon.edu 15. *** http://etc.usf.edu 16. *** http://people.eku.edu 17. *** http://www.descopera.ro


67

A STUDY ON FORMALLY INSPECTED DAIRY COWS’ MILK – A CASE STUDY

I. HUȚU

1,2, C. MIRCU

1

1Banat‟s University of Agricultural Sciences and Veterinary Medicine ”King Michael

I of Romania” from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului

Street No. 119, Timisoara, Romania

2 Innovative Agricultural Services, 8 Hartland Road, Reading Berkshire, England

and Wales


Summary

Formal control of the dairy cows‟ milk productions grants information on each cow‟s production quality and quantity. The results of the analysis report should be used both for the individual cows, and for improving the dairy farm management. Fat to protein ratio (F/P) and the milk urea nitrogen (MUN) or somatic cells count (SCC) provide information useful to farmer. As per various studies, F/P <1.1 indicates lack of fiber or energy surplus; and the ratio F/P> 1.5 indicates surplus fiber or energy deficit. A low MUN value under 8 indicates low crude protein in the ratios, improper mix of undegradable and degradable protein, and/or high rumen fermentable carbohydrates (NFC); and rates above 14 indicate crude protein possibly too high, rumen fermentable NFC possibly too low, or protein and NFC improper mix in food. SCC over 300,000 / ml milk requests inspection for detection of subclinical mastitis; while SCC over 1 million cells / ml milk requires antibiogram and mastitis treatment.

Depending on the farm size and number of cows in milk control, the study indicates energy deficit for 5 to 45% of cows; protein deficit for 0 to 20% of the farms; excess energy for 0 to 15% of the farms; excess protein in 2 to 35% of the cows; subclinical mastitis prevalence with 5 to 35% of the cows; and clinical mastitis prevalence with 2 to 10% of the cows.

Given the current social and economic background, such diagnosis requires greater involvement of the dairy associations, in order to improve the feeding and milking technologies on the dairy farms in Romania

Key words: dairy, milk constituents, formal recording

Individual and periodical analysis of milk quality for each cow is more

efficient than qualitative analysis of tank milk. Formal control of the milk production allows for an individual approach of each of the cows. Processing analysis report results becomes a must on performant management farms. Present study will advance a debate on results recorded in the analysis bulletins.


68

Materials and methods Analysis bulletin on one specific farm milk (see Fig. 1) is the first document

which allows for the assessment of the individual production quality, as well as of the health state and activity of the farm employees: care taker, milker, veterinarian, nutritionist-consultant, and such like.

Fig. 1. Milk quality analysis report

The analysis bulletin supplies information on a number of individual milk production quality indicators, as further detailed: i) fat rate; ii) protein rate; iii) casein rate; iv) urea contents (MNU – milk nitrogen urea); v) somatic cells count - SSC; vi) lactose, vii) non-fat substances; and viii) pH value.

By relating various milk constituents, ranking various values and pondering on specific threshold data, conclusions may be issued as based on: farm management; feeding technology; animals keeping technology; how the farm operators are organized and paid.

Present case study is based on information obtained over the latest 10 inspections as reported, on dairy cows farms in Western Romania by Animal Productions Laboratory; such information has been used selectively, for present comparative description (2).


69

Practically, results recorded in the analysis bulletin allows for the manager to assess both milk production of each cow under control, and the results of the employees‟ works and contract


As per information recorded in Analysis Bulletin no. 1431, dated

11.02.2014, processing of such information as per Table 1, statements on milk production are as further detailed:

- 62% (29 out of 47) of the recorded cows under formal control of milk – lactation, are indicated to lack fibers, the aspect noticed at visiting time being structural deficit, high humidity in the food share 56% water and no large particles in TMR.

- 55% (26 out of 47) of the recorded cows under formal control of milk – lactation, are indicated to manifest protein in excess; or else - more likely – imbalanced respective rates of ruminal proteins, of protein fractions and of energy (non- structural carbohydrates) – very likely an effect of ruminal acidosis.

- 30% (14 out of 47) of the recorded cows under formal control of milk – lactation, are indicated to manifest clinical or subclinical mastitis – 17% of the milk production loss by mastitis is expectable, if counteraction is not run to curb such disease.

When (positive or negative) divergence is noticed to occur, from the values recorded in Standardized lactation Chart, in excess of 10% (for performant management), -15% (for restrictive management), and -20% (for permissive management), the possible causes of such divergence will be checked as further detailed:

Fat: - lactation stage causes up to ±4.0 g/kg milk

1 (0.4%) divergence – normally

(based on physiology), fat rate goes up towards end of lactation time; - feeding errors can cause up to ±10.0 g/kg milk (1%) divergence – fat rate

goes down when the fodder is rich in concentrates and lacking cellulose, which happens based on the composition of the concentrates and on the fodder distribution regime;

- movement regime of the cows can cause ±7.0 g fat /kg milk (0.7%) divergence;

- the season can cause up to ±4.0 g/kg milk (0.4%) divergence – fat rate goes down in summer;

- several breeds concomitantly on farm; - breed genetic potential can cause up to ±40.0 g/kg milk (4%) fat rate

divergence.

1 Values can be checked for each breed apart, expressing the difference between the mean

values of the lactation last third vs. the first (idem for seasons).


70

Table 1

Processed information from Analysis Bulletin no. 1431, 11. 02. 2014 ID cow (part)

Fat Protein Urea NCS Mastitis Report G/P Urea in milk

480 3.17 2.99 18.6 222 normal 1.06 F-- P++

571 1.78 3.82 15 59 normal 0.47 F-- P++

804 1.81 3.81 18.2 52 normal 0.48 F-- P++

019 1.73 2.93 12.9 50 normal 0.59 F-- normal

828 1.93 2.93 10.5 98 normal 0.66 F-- normal

597 2.24 3.35 13.2 47 normal 0.67 F-- normal

458 2.2 3.26 21.9 641 MS 0.67 F-- P++

462 2.77 3.87 14.9 49 normal 0.72 F-- P++

818 2.22 2.86 16 348 normal 0.78 F-- P++

558 4.55 5.82 20.8 - normal 0.78 F-- P++

723 4.61 5.2 23 - normal 0.79 F-- P++

559 2.57 3.17 11.3 175 normal 0.81 F-- normal

705 2.85 3.51 20.3 271 normal 0.81 F-- P++

381 3.14 3.7 18.9 48 normal 0.85 F-- P++

035 3.38 3.74 19.2 259 normal 0.90 F-- P++

901 3.48 3.73 10.1 141 normal 0.93 F-- normal

805 3.64 3.89 18.9 1847 MC 0.94 F-- P++

817 3.74 3.89 19 410 normal 0.96 F-- P++

018 3.52 3.62 15.2 49 normal 0.97 F-- P++

820 3.33 3.41 16.8 203 normal 0.98 F-- P++

845 3.29 3.27 10.4 1411 MC 1.01 F-- normal

697 3.21 3.16 22.7 3390 MC 1.02 F-- P++

816 3.39 3.32 11.8 226 normal 1.02 F-- normal

345 3.64 3.5 12.9 157 normal 1.04 F-- normal

846 3.37 3.23 10.8 50 normal 1.04 F-- normal

819 3.94 3.77 13.4 120 normal 1.05 F-- normal

725 3.87 3.66 11.2 885 MS 1.06 F-- normal

344 3.9 3.67 9 2286 MC 1.06 F-- normal

735 3.2 3 15.8 150 normal 1.07 F-- P++

033 3.3 2.98 11.7 50 normal 1.11 normal normal


756 3.63 3.24 19.1 460 MS 1.12 normal P++

694 3.93 3.48 14.5 214 normal 1.13 normal P++


704 3.86 3.32 13.7 1215 MC 1.16 normal normal

802 4.42 3.79 22.7 198 normal 1.17 normal P++

811 3.89 3.31 24.3 2398 MC 1.18 normal P++


833 3.73 3.1 30.4 60 normal 1.20 normal P++

813 3.44 2.6 7.6 461 MS 1.25 normal P --

573 4.75 3.81 25.4 242 normal 1.25 normal P++

8822 3.86 2,93 15.1 69 normal 1.32 normal P++

966 4.34 3.26 9.9 716 MS 1.33 normal normal

455 5.86 4.37 13.8 3903 MC 1.34 normal normal

733 4.64 3.26 22.7 2941 MC 1.42 normal P++

827 5.73 3.52 19.7 1015 MC 1.63 F++ P++

829 11,51 2.42 11.7 174 normal 4.75 F++ normal


71

Legend of Table 1:

NCS MC = clinical mastitis - treatment

MS = subliclinical mastitis - CMT, treatment if coagulation is confirmed

UREE P++ = protein in excess or imbalanced ruminal protein, protein fractions and energy (non structural carbohydrates) P-- = a possible dietary protein deficiency, which can result when the rumen bacteria yield is reduced, thereby limiting milk production and milk protein yield; possible protein deficit in food share, which can lead to lessened number of rumen symbionts, thus limiting production of milk and of recorded protein in milk. (1)

G/P F-- = fiber deficit and/or energy excess

F++= fiber excess, energy deficit

Protein:

- feeding – it is the factor which most strongly determines variability of the milk protein recorded; errors in feeding can cause ±3,0 g protein/kg milk (or 0.3% divergence; in such case, checks will be run for: i) energy nature and amount; ii) protein nature and amount; iii) how fodder is preserved;

- lactation stage caused de ±3.0 g/kg milk (0.3%) divergence – protein peaks towards end of lactation;

- the season can cause ±2,0 g/kg milk divergence; while the operation regime can add up to ±2,5 g/kg milk divergence;

- breed genetic potential can cause ±3.5 g/kg milk (0.35%) divergence, when several breeds are concomitantly raised on farm (4).

Fat to protein ratio – mean values of fat, protein and fat to protein ratio

recorded milk on breeds, can be computed on information resourced by www.pedigtriu.ro; optimal value of fat to protein ratio is 1.1 to 1.5;

- values higher than 1.5 indicate energy deficit and/or fiber surplus; while values under 1.1 indicate fiber deficit (structural deficit included) and/or energy surplus;

- cows which manifest divergence from normal values will be subjected to control by the manager/ veterinarian; when 5% (performant management), 10% (restrictive management) or 15% (permissive management) of the recorded cows subjected to control indicate abnormal values of the G/P ratio, intervention is in order for correction and balancing of the group/ cows class food share Urea present in milk allows for monitoring nutritional status, especially of

the protein metabolism.2

2 In order to express the energy status, glucose will be determined, of the ketone bodies in

blood; indirectly, BCS (Body condition scoring).can be used to determine feeding technology and overall metabolism.


72

Urea recorded value, in the milk of each cow sampled, supplied particularly useful information; for individual cows in the first lactation half time, the value 10 to 14 mg urea/dl milk is taken to be normal and desirable with Holstein cows fed in mono diet technological groups, i.e. unique compound fodder (AFU); later than lactation month 5th, optimum value range narrows to 10 to 12 mg urea/dl milk

3.

As compared to values taken to be optimal, recorded urea in milk can be: - low, i.e. under 9 mg urea/dl milk, when protein deficit in the food share may

be manifest, which can cause the number of rumen symbionts to go down, thus limiting milk production and recorded protein in milk;

- high, i.e. over 14 mg urea/dl milk, when the fodder may contain too much protein (protein waste) or imbalanced ruminal protein, too many protein fractions and too much energy (non-structural carbohydrates);

- over 20 to 25 mg urea/dl milk may damage reproduction, respectively push down conception rat. i.e. to 30% lower, as compared to cows whose recorded urea in milk is optimal); and prolong the service period (3).

The number of somatic cells works as a milk quality index; the number of somatic cell recorded in milk goes up, as the cow‟s organism reacts to various infections of the mammary gland – the udder (mastitis).

Considering the analysis bulletin exemplified, the following are likely to hold: - 200,000 cells / ml milk is a point where the udder is not deemed infected; - over 300,000 cells / ml milk indicates the udder to be infected; - over 500,000 somatic cells is an index of subclinical mastitis; - 1,000,000 somatic cells is an index of clinical acute mastitis.

Practically all of the cows tested with more than 300.000 cells/ml milk somatic cells will be subjected to CMT (California Mastitis Test) or to any other type test devised for detection of subclinical mastitis.

If the recorded milk comes from a bulk tank, the following are likely to hold: - 200,000 cells/ml milk is an indication that minimum 5%of the recorded

livestock manifests subclinical mastitis; - 500,000 cells/ml milk minimum is an indication that minimum 15%of the

recorded livestock manifests subclinical mastitis Based on the specific farm management (i.e. whether performant,

restrictive or permissive) money bonus can be attributed function of mastitis incidence or prevalence/ amount of somatic cells recorded per tank. Thus, the veterinarian / the milker/ the farm operator responsible for the prevention, control and treatment of mastitis, are made directly liable for the health state of the cows; and will be paid based on their actual recorded performance.

3 Breeds manifesting more fat (e.g.Jersey) and higher body weight (e.g. Simmental type) are

to add up (to above quoted values) 1.5 – optimal interval being 11.5 to 15.5 mg urea/dl milk.


73

Conclusions Milk analysis bulletins allow for the manager to notice the dynamics of the

milk quantity/quality fluctuations, both for each individual cow, and per farm – by probing the bulk tank.

Milk analysis bulletins allow for the manager to assess both each monitored cow‟s milk production, and labor results of employees or Contractors.

Based on farm management type (i.e. whether performant management, restrictive or permissive management) optimal intervention amount can be determined for each quantifying factor of production quality.

MUN can be used effectively by nutritionists, veterinarians, and dairy producers to detect when major inadequacies – in protein or energy nutrition – occur in rumen.

Acknowledgements

To Animal Productions Laboratory which is a part of Horia Cernescu Research Unit from Banat University of Agricultural Science and Veterinary Medicine established by POSCCE project no 18 - Developing of research, service and educational infrastructure in West Region - 2669 SMIS code.

References

1. Hutjens, M., Chase, L., Interpreting MUN values. USDA Fact Sheet 2-20-

2007, 2007. 2. Huțu, I., Raport anual privind activitatea de control oficial, Innovative

Agricultural Services, Berkshire, England and Wales, 2015 3. Smith, J.F., Beaumont, S., Hagemann, L., Mcdonald, R.M., Peterson,

A.J., Xu, Z.Z., Duganzich, DM., Relationship between bulk milk urea nitrogen and reproductive performance of New Zealand dairy herds, Proceedings of the New Zealand Society of Animal Production, 2001, 61, 192-194.

4. ***The Babcock Institute (2012). Dairy Essentials. Nutrition and Feeding. Chapter 5: Protein metabolism of

dairy cows. http://babcock.wisc.edu /node/142. 5. ***www.pedigriu.ro.


74

CONSIDERATIONS ON LACTATION IN CATTLE UNDER ROMANIAN FORMAL RECORDING

I. HUȚU

1,2

1Banat University of Agricultural Science and Veterinary Medicine Michael I, King of

Romania, 300645, Aradului Street, Timisoara, Romania [email protected] 2Innovative Agricultural Services, 8 Hartland Road, Reading Berkshire, England

and Wales E-mail: [email protected]

Summary

We have charted the lactation curves for four cattle breeds considered, i.e. 4638 Holstein cows, 97 Red Holstein, 6107 Romanian Spotted-Simmental and 872 Monbeliard, which were subjected to formal milk production control during October 1

st, 2013 to

September, 30, 2014. Recorded normal lactation of the Holstein cows, through 33,137 control actions,

indicates the daily average as 21.16 kg milk, 3.96% fat and 3.31% protein (ratio F/P=1.19); and the breed average as 6453.91 kg milk. For total lactation, the top yield recorded was 17,919 kg milk. Recorded normal lactation of the Red Holstein cows through 686 control actions, indicates the daily average as 21.51 kg milk, 4.18% fat and 3.33% protein (ratio F/P=1.23); and the breed average as 6561.2 kg. The top yield recorded was 11,202 kg / total lactation. 42,288 inspections were run for the Romanian Spotted-Simmental cows, on normal lactation production; the recorded daily average was 18.10 kg milk, 3.96% fat and 3.46% protein (ratio F/P=1.15); the recorded breed average production was 5,419.52 kg. Top recorded production was 14,119 kg / total lactation. 6,999 control actions were run for the Monbeliard cows, on normal lactation production; the recorded daily average was 21.03 kg milk, 4.12% fat and 3.51% protein (ratio F/P=1.18); the breed average recorded was 6,413.28 kg. The top yield recorded, as brought to maturity equivalent, was 11,484 kg / total lactation.

Breed differences are relatively small, although marked for the milk production. i.e. F = 13.81 with p <0.001; fat - F = 5.95 with p <0.001; protein - F = 15.17 with p <0.001; and ratio F/P ratio F = 9.20 with p <0.001; which may mean that nutrition needs to be improved;

and feeding technology needs to be thoroughly sustained, especially for the Holstein type breeds.

Key words: dairy breeds, lactation, formal recording


75

In order to assess genetic value of today‟s dairy cow breeds in Romania, on the background of world trends and of Romania‟s specific cattle raising conditions, the breed melioration program set improvement directions and objections, as well as weighed economic impact of each traits‟ class, on overall melioration value. In terms of the milk production traits targeted by melioration, the factors focused on are as follows:

- milk production - fat production - protein production


Field data have been obtained by method AT4, as per Guidelines ICAR (1).

For the individual periodical control, the time lapse in-between each control and the next was 22 to 37 days, normally 28. In order to determine the milk production performances and quality thereof, diversified individual control considered minimum 7 controls‟ total valid data.

The controlor operators ran the milk production control based on the Control Report issued through the soft applied. After collecting the samples and recording the data on the Control report, such are sent to the lab; which sends the results, in electronic format, to the association headquarters, where results are automatically downloaded into the soft (application). Such system allows for a cross examination of information, i.e. data at both field obtainment time, and at download time into the soft, so that chances for the wrong data to be recorded is narrowed to a minimum. The control equipment used comes from companies certified ICAR, and the lab where the analyses are run has been subjected to accreditation procedures.

We have charted the lactation curves for four cattle breeds considered, i.e. 4638 Holstein cows, 97 Red Holstein, 6107 Romanian Spotted-Simmental and 872 Monbeliard, which were subjected to formal milk production control during October 1

st, 2013 to September, 30, 2014.

The ANOVA of SPSS software from Animal Productions Laboratory was used for variability analyses.


Recorded normal lactation of the Holstein cows, through 33,137 control

actions (Table no.1), indicates the daily average as 21.16 kg milk, 3.96% fat and 3.31% protein (ratio F/P=1.19); the breed average as 6453.91 kg milk. For total lactation, the top yield recorded was 17,919 kg milk.


76

Table 1 The milk production, fat and protein recorded for Holsten breed used for Test

Interval Method (2)

Days in Milk Quantity of

milk weighed in kg

Fat (%) Protein (%) Nr. of

recordings

5 15 22.73 4.00 3.35 1,203

16 26 23.42 4.30 3.31 1,093

27 37 23.62 3.94 3.28 1,269

38 48 23.73 4.24 3.28 1,205

49 59 23.84 3.89 3.28 1,159

60 70 23.81 3.88 3.28 1,319

71 81 23.20 3.96 3.29 1,135

82 92 23.38 3.90 3.30 1,245

93 103 22.84 3.85 3.28 1,248

104 114 22.83 3.95 3.33 1,165

115 125 22.38 3.87 3.27 1,277

126 136 21.84 3.93 3.31 1,152

137 147 21.69 3.89 3.29 1,226

148 158 21.69 3.82 3.26 1,221

159 169 21.12 3.85 3.25 1,129

170 180 20.97 3.87 3.29 1,295

181 191 20.63 3.92 3.30 1,172

192 202 20.44 4.28 3.31 1,200

203 213 20.21 3.79 3.24 1,306

214 224 19.89 3.94 3.34 1,184

225 235 19.57 3.91 3.33 1,286

236 246 19.09 3.97 3.38 1,144

247 257 18.76 3.98 3.36 1,174

258 268 18.88 3.93 3.37 1,248

269 279 18.46 3.97 3.37 1,092

280 290 18.47 4.00 3.36 1,107

291 301 17.47 3.93 3.37 983

302 312 17.53 4.00 3.38 900

In German B&W Holstein dairy farms, the milk production is 9,355 (April

2015), fat % is 3.95 and protein % is 3.36; in comparison with Romanian B&W Holstein, the German dairy farms had 1.45 time more milk production (3).

Normal lactation of the Red Holstein cows, as recorded through 686 control actions (Table no.2), indicates the daily average as 21.51 kg milk, 4.18% fat and 3.33% protein (ratio F/P=1.23); the breed average as 6561.2 kg.


77

Table 2 The milk production, fat and protein recorded for Red Holsten breed used for

Test Interval Method (2)

Days in Milk Quantity of

milk weighed in kg


recordings

5 15 24.60 4.03 3.32 24

16 26 25.03 3.81 3.09 25

27 37 24.84 4.22 3.38 23

38 48 24.78 4.17 3.35 26

49 59 24.98 3.83 3.20 26

60 70 23.63 3.99 3.28 29

71 81 22.55 3.68 3.07 24

82 92 23.88 3.96 3.24 24

93 103 21.94 4.11 3.45 26

104 114 22.73 3.77 3.23 25

115 125 21.51 4.07 3.46 22

126 136 22.14 4.10 3.33 25

137 147 23.08 3.98 3.46 22

148 158 20.33 4.45 3.44 28

159 169 22.20 4.26 3.47 24

170 180 19.25 4.29 3.49 27

181 191 19.22 4.18 3.45 26

192 202 24.02 4.16 3.46 23

203 213 19.51 4.35 3.55 32

214 224 21.22 5.69 3.42 25

225 235 20.48 4.05 3.28 25

236 246 19.40 4.22 3.55 25

247 257 21.40 4.34 3.48 26

258 268 19.85 4.19 3.46 27

269 279 17.23 4.27 3.56 22

280 290 19.17 4.45 3.58 17

291 301 17.61 4.28 3.58 22

302 312 15.76 4.22 3.41 16

In German Red Holstein dairy farms the milk production is 8179 kg (April

2015), fat % is 4.15 and protein % is 3.41; in comparison with Romanian Red Holstein, the German dairy farms had 1.25 time more milk production (3).

The top yield recorded was 11,202 kg / total lactation. 42,288 inspections were run for the Romanian Spotted-Simmental cows (Table no3.), on normal lactation production; the recorded daily average was 18.10 kg milk, 3.96% fat and 3.46% protein (ratio F/P=1.15); the recorded breed average production was 5,419.52 kg.


78

Table 3 The milk production, fat and protein recorded for Simmental type breed used

for Test Interval Method (2)

Days in Milk

Quantity of milk

weighed in kg


recordings

5 15 22.02 4.12 3.47 1.221

16 26 22.35 3.91 3.29 1.268

27 37 22.20 3.86 3.23 1.298

38 48 21.65 3.85 3.24 1.379

49 59 21.70 3.85 3.27 1.355

60 70 21.06 3.83 3.28 1.404

71 81 20.66 3.87 3.29 1.388

82 92 20.11 3.82 3.32 1.406

93 103 19.93 3.89 3.34 1.449

104 114 19.87 3.85 3.37 1.460

115 125 18.99 3.88 3.40 1.498

126 136 18.89 3.88 3.41 1.468

137 147 18.77 3.88 3.42 1.589

148 158 17.87 3.94 3.44 1.569

159 169 18.17 3.96 3.48 1.586

170 180 17.35 3.92 3.49 1.638

181 191 17.21 3.95 3.49 1.627

192 202 17.15 3.98 3.51 1.696

203 213 16.39 4.22 3.52 1.732

214 224 16.38 3.96 3.55 1.762

225 235 15.67 4.03 3.56 1.799

236 246 15.55 4.02 3.76 1.775

247 257 15.15 4.01 3.58 1.724

258 268 14.72 4.12 3.62 1.706

269 279 14.70 4.08 3.61 1.558

280 290 14.13 4.13 3.65 1.447

291 301 14.15 4.10 3.62 1.271

302 312 13.92 4.09 3.66 1.215

In German R&W dual purpose dairy farms the milk production is 6855 kg

(April 2015), fat % is 4.30 and protein % is 3.49; in comparison with German R&W, dual purpose breeds in the German dairy farms had 1.24 time more milk production (3).

Top recorded production was 14,119 kg / total lactation. 6,999 control actions were run for the Monbeliard cows (Table no. 4), on normal lactation


79

production; the recorded daily average was 21.03 kg milk, 4.12% fat and 3.51% protein (ratio FP=1.18); the breed average recorded was 6,413.28 kg. The top yield recorded, as bought to maturity equivalent, was 11,484 kg / total lactation.

Table 4

The milk production, fat and protein recorded for Monbeliard breed used for Test Interval Method (2)

Days in Milk

Quantity of milk

weighed in kg


recordings

5 15 22.17 4.14 3.53 255

16 26 22.34 4.01 3.36 257

27 37 23.59 3.88 3.31 258

38 48 22.65 3.89 3.35 265

49 59 22.79 4.02 3.34 245

60 70 23.17 3.87 3.37 259

71 81 22.14 3.85 3.35 263

82 92 21.91 5.49 3.57 244

93 103 21.66 3.94 3.42 277

104 114 21.68 4.01 3.43 259

115 125 22.32 3.93 3.47 263

126 136 21.25 3.99 3.50 289

137 147 21.23 3.96 3.48 242

148 158 21.22 4.04 3.49 274

159 169 21.12 3.98 3.51 251

170 180 20.82 3.99 3.53 272

181 191 20.96 4.14 3.54 254

192 202 20.75 4.10 3.56 245

203 213 20.65 4.06 3.56 269

214 224 20.65 4.19 3.57 241

225 235 19.90 4.24 3.60 264

236 246 19.99 4.17 3.59 261

247 257 19.25 4.30 3.64 239

258 268 18.87 4.19 3.64 234

269 279 19.07 4.23 3.64 233

280 290 19.34 4.29 3.62 214

291 301 18.72 4.21 3.63 199

302 312 18.55 4.31 3.61 173

Breed differences are relatively small, although marked for the milk

production. i.e. F = 13.81 at p <0.001; fat - F = 5.95 at p <0.001; protein - F = 15.17


80

t p <0.001; and ratio F/P ratio F = 9.20 to p <0.001; which may mean that nutrition needs to be improved; and feeding technology needs to be thoroughly sustained, especially for the Holstein type breeds.

Acknowledgements

To Animal Productions Laboratory which is a part of Horia Cernescu

Research Unit from Banat University of Agricultural Science and Veterinary Medicine established by POSCCE project no 18 - Developing of research, service and educational infrastructure in West Region - 2669 SMIS code.

Conclusions

Formal control of milk production has a comeback; 4638 Holstein cows, 97

Red Holstein, 6107 Romanian Spotted-Simmental and 872 Monbeliard, were subjected to formal milk production control during October 1

st, 2013 to September,

30, 2014. Romanian dairy farms need to improve the feeding technology, as, using

more or less the same bulls, the Germans Holstein dairy farms recorded 1.45 times more milk, German Red Holstein farms 1.25 times more milk and German dual purpose breeds 1.24 times more milk, then the correspondent Romanian breeds.

References

1. ***INTERNATIONAL COMMITTEE FOR ANIMAL RECORDING – ICAR,

Guidelines approved by the General Assembly held in Cork, Ireland, on June 2012.

2. ***www.pedigriu.ro 3. ***Estimation of Breeding Values for Milk Production Traits, Somatic Cell

Score, Conformation, Productive Life and Reproduction Traits in German Dairy Cattle available at http://www.vit.de/fileadmin/user_upload/vit-fuers-rind/zuchtwertschaetzung/milchrinder-zws-online/Zws_Bes_eng.pdf


81

THE ASCEDING AORTA IN PIGS - ANATOMICAL ASPETCS -

CARMEN JECAN, A. DAMIAN, IRINA IRIMESCU, C. MARTONOŞ, F. TUNS

Anatomy Department, University of Agricultural Sciences and Veterinary Medicine,

400372, Calea Manastur Street, no.3-5, Cluj Napoca, Romania E-mail: [email protected]

Summary

The aorta presents a very short ascending segment, so that certain anatomists have even asserted that it does not exist (6). It continues with the aortic arch, which gives off the branches providing the blood supply for the head and for the cranial segment of the organism - the brachiocephalic trunk and the left subclavian artery. The brachiocephalic trunk splits itself into the right subclavian artery and the bicarotid trunk. The latter advances cranially and ends cranially to the plane of the first rib, by division into the common carotid arteries. The terminals of the common carotid arteries are given off under the alla of the atlas

and are represented by the external carotid artery and by a common trunk, composed of the internal carotid artery and the occipital artery. Our present study has investigated the anatomic particularities in pigs of the aorta, of the brachiocephalic trunk, of the bicarotid trunk and of the common carotid arteries.

Key words: ascending aorta, brachiocephalic trunk, bicarotid trunk, pig

Our study aimed to investigate the pig‟s aorta, focusing on its ascending

segment, on the brachiocephalic trunk and on the bicarotid trunk. The main objectives for attaining this goal were:

a) to perform anatomical dissections on fresh cadavers; b) to perform dissections on bodies injected with colored plastic masses,

like latex, in order to highlight the origin and the path of the studied arteries.

Materials and methods Our study aimed to investigate the pig‟s aorta, focusing on its ascending

segment, on the brachiocephalic trunk and on the bicarotid trunk. The main objectives for attaining this goal were: 5 adult mixed breed pig carcasses were used for this study (3 males and 2 females, weighting between 80 and 100 kg). We have highlighted the aorta from its cardiac origin until the aortic arch, following the length of the brachiocephalic trunk and of the bicarotid trunk. The anatomic samples have been examined in view of isolating the aorta and its branches, by latex injection (colored plastic mass).

The first step of the dissection consisted of isolating the common carotid arteries, in order to verify vascular permeability (Fig.1).


82

We have then injected the colored latex into the left ventricle, until it has reached the common carotid arteries. After the injection, the cadavers have been bathed for 48 hours in a 2% formalin solution to fixate them and to allow the hardening of the injected material, in view of a better examination following the stratigraphic dissection of the existing anatomical relations.

Fig.1. Common carotid artery in the middle third of the jugular groove

Results and discussions The ascending aorta is the first segment of the main arterial vessel of the

body - the aortic artery. In the examined individuals, we have highlighted the origin of the aorta as the aortic orifice at the base of the left ventricle. Following the latter, we have also identified the aortic bulb - a slightly dilated segment.

The aortic bulb is directly continued by a flexure oriented to the left, representing the aortic arch, so that there is no actual ascending segment of the aorta, such as we find well represented in other species (Fig.2).

The aortic cross has no significant caliber variations by comparison to the aortic bulb. The brachiocephalic trunk detaches itself from the first segment of the aortic arch (Fig.2).

The brachiocephalic trunk in pigs is considered to be the superior limit of the ascending aorta, the limit between the aortic bulb and the aortic arch. It is the first branch of the aortic arch and it was identified in all of the dissected specimens. Its origin is placed at 1-2 cm from the aortic bulb; at the level of the superior flexure of the aortic arch and it present a rather large caliber, when compared to the other branches. After its origin, it orients itself cranially and slightly to the right.


83

The anatomical limit of this vascular segment is represented by the branching off of the right subclavian artery. In the dissected subjects, this limit was situated at an average of 2-3 cm from the origin of the vessel, with individual variations (Fig.2).

After giving off the right subclavian artery, the right brachiocephalic trunk is continued by a short bicarotid trunk. The latter goes cranially between the two subclavian arteries and it ends bifurcated under a narrow angle, cranially to the plane of the first rib, into the two common carotid arteries - right and left (Fig.3).

The common carotid arteries have an ascending trajectory along the jugular groove, accompanied by the superficial jugular veins and by the vago-sympathetic trunk.

Fig.2. Aortic arch and its branches:

1.Heart; 2.Aortic arch; 3.Brahcicephalic trunk; 4.Left subclavian artery; 5.Right subclavian artery; 6.Right internal thoracic artery; 7.Right axillary artery;

8.Bicarotid arterial trunk; 9.Common carotid arteries; 10.Trachea. In their cervical segment, the common carotid arteries give off small

muscular, tracheal, esophageal branches and the cranial and caudal thyroid


84

arteries. In the cephalic segment, we have identified important branches for the blood supply of the pharynx and of the larynx. The terminals of the common carotid arteries result from the bifurcation situated under the alla of the atlas; they are represented by the external carotid artery and a common trunk for the internal carotid artery and the occipital artery.

Fig.3. Bicarotid trunk (1) and common carotid arteries (2 and 2‟)

The first segment of the aorta presents a very short length of 1-2 cm on

average, which can‟t truly constitute a real ascending aorta, thus Gheţie et al. (6) assert that in pigs the ascending aorta is missing. We consider that the ascending aorta in pigs refers to the segment between its origin - the aortic orifice, and the plane of the 4

th thoracic vertebra, where the thoracic aorta begins, an aspect also

mentioned by Damian, in 2001. We can also state that in pigs the diameter of the aortic bulb (a segment

present in all mammalian species) is the same starting at the origin in the left ventricle and ending at the aortic arch. There is little macroscopical difference between the segment of the aortic arch and that of the aortic bulb.

The aorta is very developed in the dissected specimens, and presents thick walls and a large lumen (1,2,3).

1

2

2’


85

After emerging from the pericardial sac, the aorta continues with the aortic arch, from which branches are given off for the blood supply of the head and of the anterior segment of the body. At the base of the heart we have identified the separate origin of the two branches given off by the arch: the brachiocephalic trunk and the left subclavian artery. The aorta is continued from this level by the aortic arch.

The brachiocephalic trunk does not present a very large caliber due to the fact that is only gives off the right subclavian artery, and it is then continued by the bicarotid trunk, which ends by bifurcating itself into the two common carotid arteries (7).

The bicarotid trunk is the continuation of the brachiocephalic trunk and it also splits in its turn at the level of the first pair of ribs into the two left and right common carotid arteries (5). The latter are accompanied laterally by the jugular vein; dorso-medially, by the vagosympathetic trunk and ventrally, by the recurrent laryngeal nerves.

The common carotid arteries end in the cranial segment of the jugular groove by giving off the external carotid artery and a common trunk composed of the occipital artery and the internal carotid artery (4,7).

The common carotid arteries have a significantly smaller caliber than that of the subclavian arteries (8).

The length of the brachiocephalic trunk and that of the bicarotid trunk vary considerably according to the breed and the subject.

Conclusions

The origin of the aortic artery is represented by the aortic orifice situated at

the base of the left ventricle. The aortic bulb is the first segment of the aorta. The aorta is directly continued from the level of the aortic bulb by the aortic

arch, without presenting an actual ascending segment. There were no significant caliber variations between these segments of the

aorta, nor a clear limiting line between them, in all of the dissected specimens. The aortic artery is very well developed, presenting a large lumen and

relatively thick walls. In pigs, the aortic arch gives off two branches - the brachiocephalic trunk

and the right subclavian artery. The brachiocephalic trunk originates immediately after the flexion of the aortic artery and it also presents a large caliber.

The bicarotid trunk is the direct continuation of the brachiocephalic trunk, after the detachment of the right subclavian artery; it ends in a narrow angled bifurcation leading to the two common carotid arteries.


86

References

1. Alsaif, H.A., Ramadan, W.S., An Anatomical Study of the Aortic Arch Variations, JKAU: Med. Sci., 2010, 17(2), 37-54.

2. Chirilean Ioana, Damian, A., Crișan, Melania, Stan, F., Dezdrobitu, C., Anatomical Contributions Regarding Aortic Opening (Aortic Orifice) and the Right Coronary Artery in Swine, Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca, Veterinary Medicine, Volume 66, Issue l/2009, 26-33.

3. Chirilean Ioana, Damian, A., Crișan Melania, Stan, F., Dezdrobitu, C. Anatomical contributions regarding the peculiarities of the right coronary artery in Swine, Anatomia, Histologia, Embryologia, 2010, 39 (4), 273.

4. Coţofan, V., Palicica, R., Ganţă, Carmen, Hriţcu, Valentina, Enciu, V. Anatomia animalelor domestice, Vol. III, Aparatul circulator - Sistemul nervos, Ed. Orizonturi Universitare, Timişoara, 2000. Pp. 29, 37-66.

5. Damian, A., Anatomie comparată - Sistemul Cardiovascular, Ed. Academic Pres, Cluj-Napoca, 2001.

6. Gheţie, V., Bica Popii, O., Chiţescu, St., Nicolescu, V., Oprişescu, V., Bălănescu, Fl., Anatomia animalelor domestice, Ed. Didactică şi Pedagogică, Bucureşti, 1967, pp. 108, 400, 467, 468-503.

7. Popovici, I., Damian, A., Popovici, N.C., Chirilean Ioana, Anatomie comparată - Angiologie, Ed.Genesis, Cluj-Napoca, 1998, pp. 39-47.

8. Tuns, F., Iurcuţ Alina, Chirilean, Ioana, Blendea Alexandra, Damian, A., Contributions over the anatomy of primitive aorta and its main branches in swine, Contributions of scientific research to the progress of veterinary medicine, București, 2013.


87

THE POSTDIAPHRAGMATIC SEGMENT OF THE GASTROINTESTINAL TRACT IN THE DOG AND IN THE CAT

- A COMPARATIVE ANATOMICAL STUDY -

CARMEN JECAN1, A. DAMIAN

1, Ş. COSMA

1, C. NUŢ

2, F. GHIURCO

2,

IRINA IRIMESCU1

1University of Agricultural Sciences and Veterinary Medicine, 400372, Calea

Manastur Street, no.3-5, Cluj Napoca, Romania 2Directia sanitară veterinară şi pentru siguranţa alimentelor Zalău, Salaj


Summary

The current study provides a more detailed anatomical description of the features of the external surface of the postdiaphragmatic gastrointestinal tract for the main pet species - the dog and the cat. The importance of the digestive pathology in both species and the necessity to adapt treatments in order to better suit their particularities - linked mainly to nutrition differences, underlines the need of a more detailed knowledge of the gastrointestinal segment anatomy of these domestic carnivores.

The project was carried out in the Comparative Anatomy Laboratory of the Faculty of Veterinary Medicine of Cluj-Napoca, consisting of the dissection of 5 dog corpses and 5 cat corpses followed by the examination their gastrointestinal tracts. The focus was on the general features of each species, while avoiding breed particularities.

Our study has demonstrated that the main morphological external differences at this level, between the dog and the cat, are found in the stomach, in the duodenum and, in a smaller degree, in the other segments of the intestinal mass.

Key words: digestive tract, anatomy, dog, cat

Gastrointestinal diseases of the dog and of the cat make up an important part of the general pathology that a veterinarian has to face in the usual day-to-day practice. There is a growing need to understand how the dietary differences in the two species have shaped their digestive systems, in order to better adapt therapeutic protocols to their needs.

During the last decades, there have been important changes in the lifestyle and nutrition style of these animals, from hunting and foraging to home cooked food and professional diets. While a lot of differences reside at metabolic and physiological levels, they implicitly generate separate features at a macroscopic level of each segment of the gastrointestinal tract.

Our study aims to initiate a more detailed view of the anatomical discrepancies in the digestive system between dogs and cats, by providing a description of the postdiaphragmatic segment of the gastrointestinal tract of both species, while underlining the main differences in topography and in internal and


88

external morphology between the two. This paper will be focused on the placement and external features of the stomach and intestinal mass of the dog and of the cat.


The study was performed on 5 dog corpses (3 males, 2 females) and 4 cat

corpses (1 male, 4 females). All animals were adults of different ages and common mixed breed, with different death causes that did not involve lesions of the digestive system. No pure breeds were included in the study, in order to avoid confusions between species and breed related anatomical peculiarities.

The corpses were dissected at the Anatomy Laboratory of the Faculty of Veterinary Medicine of Cluj-Napoca, using standard dissection tools and methods.

The procedure was applied in the first two hours after the occurrence of death, in order to avoid post mortem artefacts. When it has not possible, the bodies were preserved by freezing them at low temperatures (-18ºC).

A common dissection technique was used to highlight the postdiaphragmatic segments of the gastrointestinal tract. The abdominal walls were cut out and the normal topography of the digestive tract inside the abdominal cavity was studied.

The postdiaphragmatic segment of the gastrointestinal tract was then isolated by sectioning the esophagus above the cardiac orifice, by detaching the anal orifice from the surrounding tissues and by detaching the peritoneal folds and ligaments holding the digestive tract to the abdominal cavity walls and to the surrounding organs.

Each segment of the gastrointestinal tract was identified, its external features examined, and then opened along its longitudinal axis. The gastric and intestinal content were removed and the segments were washed in order to allow an accurate examination of their internal features.


In the following paragraphs, we will present the main findings regarding the

distinctive external features of the postdiaphragmatic gastrointestinal tract in the dog and in the cat starting with its general topography and describing each segment in their normal succession according to the direction of content flow: the stomach, the duodenum, the jejunum, the ileum, the cecum, the colon and the rectus (4).

The placement of the various segments of the digestive tract inside the abdominal cavity noticed during the dissection of the cadavers indicates that their topography can greatly vary according to their plenitude degree, especially for the stomach. This fact has previously been signalled by several authors (1,2,4). There were, however, no important differences between the two species, so we will discuss the general topography of both (Fig.1A and 1B).


89

Similar to other species, like swine, in the cases of an empty stomach, it is completely covered by the left hypochondrium, separated from the abdominal wall by the intestinal mass. A fuller stomach touches the abdominal wall and pushes caudally the jejunum, while pulling the spleen towards the hypochondrium.

In two individuals with an average plenitude state, the body of the stomach was reached under the dorsal extremity of the 10

th, 11

th and 12

th ribs and the

pylorus was placed near the hepatic hilum, off the 10th rib, but not far from the

median plane, concurring with the literature (1). The whole organ was projected caudally near to the last left rib.

In the case of individuals with a high plenitude state, this projection was farther removed caudally, reaching the 5

th or 6

th lumbar vertebrae.

Fig.1. Ventral view of the gastrointestinal mass inside the abdominal cavity in the

dog (A) and in the cat (B) In dogs, the volume and total capacity of the stomach in the dissected

bodies varied a lot according to body size, nutrition and plenitude level. The weight varies too (cca.100-230g). Individual variations were smaller in cats.

At a medium plenitude level, the external aspect of the stomach is composed of a short fundic segment and a narrow pyloric region highly raised up to the right of the stomach‟s body, placing it close to the cardia (Fig.1), (1,5).

The Cardia is very highly placed, marked by a sudden enlargement of the terminal portion of the esophagus (Fig.2), but its location is higher with regards to the large curvature in cats (Fig.2B) than in dogs (Fig.2A). The left side, composed of the fundus and of the body tend to have a spherical shape, especially when the organ is distended which renders and appendage aspect to the pyloric region. The

A B


90

small curvature is split by a small angular notch, and the large curvature is extremely long. The later is aborally oriented in dogs and oblique in cats, reaching towards the abdominal wall (Fig.1). The shape of the body of the stomach is slightly elongated in dogs, while it is globular in cats (Fig.2). In the dog specimens, the duodenum had an average length of 30 cm (Fig.3A). Its origin can be projected at the middle level of the 9

th right rib. In cats, the duodenum has an even more

reduced length (12 cm on average) (Fig.3B). The curve between the duodenum and the jejunum is situated near the cranial pole of the left kidney.

Both species present a particular feature a major and a minor duodenal papilla. The major pancreatic duct (Wirsung) and the bile duct both open in the major papilla, situated near the cranial curve of the duodenum, at 2-3 cm form the pyloric orifice. The minor papilla is found at 1.5-2 cm further from the major one and receives the minor pancreatic duct. Its presence varies greatly in cats: it was

Fig.2. General aspect of the stomach in the dog (A) and in the cat (B)

Fig.3. General aspect of the duodenum in the dog (A) and in the cat (B)

A B

A B


91

present in a single individual from the entire group. Barone (1), Popovici (7) and other author concur on this fact.

In the dog specimens, the jejunum and the ileum occupy the whole abdominal region and the flanks, from the hypochondrium to the pelvis. They are moved caudally when the stomach is full, and cranially if the urinary bladder is distended. The jejunum has eight great loops (Fig.4A) and the ileum, which is short (Fig.5A), is oriented in a straight cranio-dorsally direction from the pubic region to meet the origin of the colon, medially to the right kidney. In cats, the jejunum-ileum (Fig.4B and 5B) visibly increases in girth in its second half.

Fig.5. General aspect of the ileum in the dog (A) and in the cat (B) The cecum is situated in the right flank, passed the 3

rd or 4

th lumbar

vertebra, medially or dorsally to the duodenum as cited in literature (2). Following the dissection and examination of the dog specimens, we have noticed that the cecum is poorly developed, and varies greatly in size and volume. It is very small (5 cm in length and 1 cm in width on average) and it is twisted in an irregular spiral, with a rounded end oriented ventro-cranially or transversally (Fig.6A).

In the dissected cat specimens, the cecum was proportionally smaller than that of the dogs, with a smoother shape. It is 2 to 3 cm long and curved in a hook-like shape with a rounded end (Fig.6B). The concave curve is oriented towards the ileum.

Fig.4. General aspect of the jejunum in the dog (A) and in the cat (B)

A B

A B


92

Fig.6. General aspect of the cecum in the dog (A) and in the cat (B) In dogs, the colon is only 3 cm in girth and 40 cm on average in length. It is

smooth, with a very simple shape and its different segments are poorly delimited, with much reduced curves (Fig.7A).

The ascending colon is very short, placed near the first two lumbar vertebrae and it was absent in one case. The transverse colon is just as short; it surrounds the root of the omentum, forming a curve at the level of the last thoracic vertebra, with its concavity placed caudally. The descending colon is the best developed part of the large intestine and it is almost straight, just as described in literature (7). In two cases, the last segment of the descending colon presented a slight inflexion, representing the sigmoid colon.

In cats, the colon has a clearly bigger caliber than the small intestine (Fig.7B). The ascending and transverse colon are even shorter than in dogs, merged into a single loop which surrounds the cranial border of the omentum and is continued with the descending colon. In all the studied specimens there was no sign of a sigmoid colon. The rectum extends itself from the aperture of the pelvic cavity to the 4

th coccygeal vertebra. It is short in dogs (5 cm in length on average)

with a small rectal ampulla (Fig.7A). In cats the rectum is also proportionally short (Fig.7B). This also concurs with previous descriptions (1,6).

Fig. 7. General aspect of the colon and of the rectum in the dog (A) and in the cat (B)

The rectum extends itself from the aperture of the pelvic cavity to the 4

th

coccygeal vertebra. It is short in dogs (5 cm in length on average) with a small rectal ampulla (Fig.7A). In cats the rectum is also proportionally short (Fig.7B). This also concurs with previous descriptions (1,6).

A

A

B

B


93

Conclusions

Both species present a postdiaphragmatic gastrointestinal segment proportionally smaller than in other species, demonstrating a fast content transit corresponding with the carnivorous lifestyle.

Gastrointestinal topography greatly varies according to organ plenitude levels, but there are no important differences between the two studied species, especially at the intestinal mass level.

In dogs, the large curvature of the organ is aborally oriented, towards the intestinal mass, while in the cat it has an oblique orientation, towards the abdominal wall. The shape of the body of the stomach is slightly elongated in dogs, while it tends to be spherical in cats, in which the cardia has a higher location with regards to the larger curvature of the stomach than in dogs.

In the duodenum, both species present a major and a minor duodenal papilla, but in cats, it was present in just one case out of the five which have been dissected.

The jejunum and the ileum have a relatively uniform girth in the dog, while in the cat, the diameter increases visibly in the jejunal segment.

In the large intestine, the cat‟s cecum is conically shaped and much smaller than in the dog. In turn, the dog has a corkscrew shaped cecum.

The colon has a similar conformation in both species, but the ascending and transverse regions are much more reduced in the cat, having an incurved shape.

References

1. Barone, R., Anatomie comparée des mamiferes domestique, tome III, Spanchnologie: Appareil digestif - Appareil respiratoire, Ecole Nationale Veterinaire de Lyon, pp. 291-497, 1984.

2. Coţofan, V., R. Palicica, Carmen Ganţă, V. Hriţcu, V. Enciu - Anatomia animalelor domestic, vol. II, Editura ”Orizonturi universitare”, Timişoara, pp. 83-201, 2007.

3. Damian, A., Ioana Chirilean - Anatomie topografică comparată, Ed. Academic Pres, Cluj-Napoca, pp. 65-70, 2002.

4. Garcia, Abreu Emerita - Anatomia comparada de los Animales Domesticos, Universidad Nacional Experimental „Francisco de Miranda”, Santa Ana de Coro, pp. 50-131, 2005.

5. Gheţie, V., Bica Popii, O., Chiţescu, St., Nicolescu, V., Oprişescu, V., Bălănescu, Fl., Anatomia animalelor domestice, Ed. Did. şi Pedagogică, Bucureşti, pp.34-89, 1967.

6. Klaus-Dieter, B., McCarthy, P.H., Fricke, W., Richter, Renate, Anatomy of the dog, pp. 50-57, 2007.

7. Popovici, I., Damian, A., Popovici N., Chirilean, Ioana, Tratat de anatomie comparată: Splanchnologie, Ed. Academic Pres, pp.103-164, 2006.


94

THE ASSESSMENT OF SEROTONIN IN DOGS

TIMEA KOCIS, LYDIA TOT, ASTRID GROSZLER, I.ȚIBRU, C. LĂZĂRESCU

Banat‟s University of Agricultural Science and Veterinary Medicine Timisoara “King Michael of Romania”, Faculty of Veterinary Medicine, 300645, Aradului Street, No.

119, Timisoara, Romania E-mail: [email protected]

Summary

The aggressive behavior of dogs has a negative impact on public safety and health, the number of people getting bitten by dogs increasing each passing day.

The aggressive behavior also has an impact on animal welfare, representing one of the most common causes of abandonment and euthanasia.

A major role in displaying the aggressive behavior is played by serotonin, a hormone that can be correlated with an obsessive-compulsive behavior, with aggression and anxiety.

In the present study, a sorting in two lots of dogs has been made, aggressive and non-aggressive, based on serotonin concentration. The dogs which displayed aggressive behavior had lower concentrations of this neurotransmitter, in comparison to the non-aggressive lot of dogs.

Key words: aggressive, dog, serotonin

Statistics show that over one million people are bitten annually all lover the world, and dog bites represent circa 1% of medical emergency cases, but it is estimated that this number represents only half of the total number of such events, the rest not being reported. The same statistics show that half of the victims are children younger than 10 years of age (1).

Even if most bite generated wounds are minor, it does not follow that the phenomenon should be ignored or downplayed. Aggressive behaviour in dogs has a negative impact on the public health and safety, the number of bitten persons rising, but also on the animals‟ welfare, aggressiveness representing the most frequent cause for abandonment and euthanasia (4).

The behaviour of each animal species follows a pattern, and deviations from this pattern are classified by specialists as pathologic. Aggressiveness is one of the normal dog pack behaviours. Still, dog aggressiveness is the most frequent reason for owners to address veterinarians specialized in behaviour therapy. Dog behaviour is influenced by genetics and environmental factors (2).

The aggressive behaviour is classified in affective aggressive behaviour (offensive and defensive) and non-affective aggressive behaviour (predator aggressiveness). Affective aggressiveness is associated with the activation of the autonomous nervous system and involves neurotransmitters such as serotonin, dopamine, noradrenalin, acetylcholine, gamma amino butyric acid (3).


95

Non-affective aggressiveness is controlled by acetylcholine and does not involve the autonomous nervous system activation (3). Dog body language differs for the two aggressiveness categories, as well as the involved cerebral areas (5).


The study included a number of 18 dogs, 10 of which came from a public

shelter, and 8 from private ownership. The private ownership lot included 2 German shepherd dog, a German shepherd half-breed, 3 Romanian Mioritic shepherd half-breeds and 2 medium size half-breeds.

Each dog was filmed and photographed at the time they were collected, in order to analyze the momentary behaviour in comparison with the data provided by the owner. With dogs coming from shelters, the behavioural anamnesis was based on information provided by the care-takers, and the dogs showing no signs of aggressiveness were selected for the experiment.

A blood sample was taken from each dog from the cephalic vena using harvesting needles (19G), in 6 ml vacutainers without anticoagulant. The blood samples were deposited at room temperature for 2 hours, and afterwards were centrifuged at 3500 rotation/minute for 5 minutes. The expressed serum was collected with Pasteur pipettes and was deposited in Eppendorf pipettes in the freezer at -40 degrees Celsius until the serotonin determination.

The serum serotonin determination was carried out with a MikroWin 2010, Version 5 device, using the Serotonin ELISA Enzyme Immunoassay for the Quantitative Determination of Serotonin in Serum, Plasma and Urine kit, from the DLD Diagnostika firm in Hamburg, Germany. The determintions were undertaken in the Horea Cernescu laboratory complex from BUASVM Timișoara, Faculty of Veterinary Medicine.


The obtained results are shown in table 1, and, following the statistic

interpretation, with the dogs in the first lot we registered an average serotonin value of 182.50 ng/ml, with a 26.40 standard deviation and a 38% variability coefficient.

Table 1

1st

Lot OWNED DOGS

Dog ID Serotonin (M3)

1 149.19

9 115.52

13 253.76

17 298.17

21 111.73

27 181.64


96

29 167.50

33 210.71

Data Interpretation As a result of the statistic analysis, based on the Variability Coefficient,

over 30%, we can affirm that we are dealing with a non-homogenous lot. The serotonin value variations can be explained based on the individual variability.

The obtained results are shown in table 2, where, from a statistic point of view, the average serotonin value in shelter dogs was of 388.01 ng/ml, with a 117.50 standard deviation and a 30.28% variability coefficient. With a coefficient value vary close to 30%, we may conclude that the lot was relatively homogenous.

Table 2

2nd

Lot DANIFLOR DOGS

Dog ID Serotonin (M0)

1D 453.80

2D 350.02

3D 313.89

4D 285.03

5D 472.07

6D 488.70

7D 330.52

8D 190.01

9D 303.49

10D 591.15

The study results are similar to the data published in speciality literature, in

the Assessment of serotonin in serum, plasma and platelets of aggressive dogs paper published by Marta Leon, Belen Rosado, the serotonin values in aggressive dogs were lower, 209.6 ng/ml as compared to those in non-aggressive dogs, 282.5 ng/m (4)l.

Another study, carried out by Marta Amat et al. 2013, aimed to establish whether the English cocker spaniel breed is more aggressive than dogs pertaining to other breeds, due to lower serotonin values. All dogs included in the study were diagnosed with affective aggressiveness, the average serotonin values in English cocker spaniels being of 318.6 ng/ml as compared to average values of 852.77 ng/ ml in other dog breeds. There was a significant difference between values obtained in English cocker spaniel dogs as compared to other breeds of dogs (P< 0.05) (1).


97

Conclusions

The obtained serotonin values allow us to affirm that during the aggressive moment the serotonin decreases, reaching 182.5 ng/ml as compared to the average obtained from the shelter dog lot, where the value was higher, namely 388.01 ng/ml.

The 388.01 ng/ml serotonin value in shelter dogs, as compared to 182.50 ng/ml, is due to their continual aggressiveness state in their struggle for survival.

Acknowledgments

This paper was published under the frame of the European Social Fund,

Human Resources Development Operational Programme 2007-2013, project no. POSDRU/159/1.5/S/132765.

References

1. Amat, M., Le Brech, S., Torrente, C., Differences in serotonin serum concentration between aggressive English cocker spaniels and aggressive dogs of other breeds, Journal of Veterinary Behavior, 2013, 8, 19-25.

2. Beaver, B.V., Canine Behavior Insights and Answers, 2nd Ed. Saunders Elsevier, St. Louis, MO, 2006, 133-192.

3. Dodman, N.H., Shuster, L.,. Pharmacologic approaches to managing behavior problems in small animals, Vet. Med. 1994, 89, 960.

4. Leon, M., Rosado, B., Belenguer, S. G., Assessment Of Serotonin In Serum, Plasma And Platelets Of Aggressive Dogs, Journal of Veterinary Behavior 2012, 7, 348-352

5. Moyer, K.E.,. Kinds of aggression and their physiological basis, Commun. Behav. Biol. 2(Part A), 1968, 65-87.


98

ANIMAL MODELS IN VETERINARY MEDICINE FROM ANATOMICAL PERSPECTIVE

C. MARTONOS¹, M. PENTEA²

¹University of Agricultural Sciences and Veterinary Medicine, Department of Comparative Anatomy, Faculty of Veterinary Medicine Cluj-Napoca, 3-5, Manastur

Street, 400372, Romania

²Banat‟s University of Agricultural Sciences and Veterinary Medicine ”King Michael I of Romania” from Timisoara, Faculty of Veterinary Medicine


Summary

Animal use as an experimental model for different pathologies brings a substantial contribution to the understanding of various diseases pathogenesis mechanisms leading to the development of new diagnostic techniques. Also, the primary pharmacological models are performed on the animal models, from the simplest vaccines testing to the complex antitumor therapies.

All these are justified reasons in a research approach to highlight the anatomical particularities of the most commonly used experimental models due to which these animals have predilection for a particular field of research. Large animals are also used in research, having anatomical similarities with humans, but these animals are difficult to obtain and the maintenance costs are high. Also, the follow up of the entire process in real time and the needs of many subjects for statistical relevance are impediments that must be taken into account. In this context, nowadays, small animals are preferred as experimental research models. This study performed a review of anatomical particularities of small animals commonly used in medical research related to the specific domain of use. Also, depending on the degree of anatomical similarities, this study provided a critical analysis of the opportunity of using animals in specific medical domain, wanting to be a guide in planning research protocol.

Key words: anatomy, experimental models, lymphatic system, digestive system

Nowadays morphology is the most important branch of medicine. To diagnose or treat various diseases a deep knowledge of what is normal is required in order to achieve differentiation of pathological issues (2,4,8,9) Moreover, the structure of each component of anatomical systems has direct implication in functional anatomy. For example, “blind-ended” lymphatic precapilar vessels morphology (8) favors the entry of tumor cells into the lymphatic circulation. The anatomy of the various components of the digestive tract of animals is a direct result of digestive strategy (6,9). The asymmetrical arrangement of kidneys due to the various developments of some digestive components (e.g. stomach, cecum, colon) is a common feature found in rabbits, guinea pigs and chinchillas (5).

This paper performs a review of the main anatomical features of small animals that have been studied in Comparative Anatomy Department of our faculty,


99

used mainly in research related on the lymphatic and digestive systems. Also a brief analysis of scientific literature will be provided, aiming to be a guide for choosing the research protocols. The first part summarizes the main anatomical features of the lymphatic system in terms of morphological identification, involvement in the lymphatic metastasis especially in female dog mammary gland tumors followed by a description of the modern ultrasound technique used in lymphatic system evaluation. The second section refers to the anatomical particularities of the digestive tract of small animals used as experimental models. SECTION I

Anatomical methods for identifying lymphatic vessels and lymph nodes

The anatomical methods such as direct lymphography using radiographic contrast agents, or indirect lymphography based on intradermal or subcutaneous injection of coloring solution are within reach of anatomical studies (2,4,13,17,20,21). Because a lymphatic vessel catheterization is very difficult due to brittleness and the path often very tortuous, numerous studies were performed by prior injection of dye into the territories of interest followed by cannulation of the identified lymphatic vessel and intraluminal injection of contrast agent (22,23,24).

Thus mapping of lymphatic drainage was performed in dogs (22,24), rabbits (20) and mice (23), demonstrating the existence of distinct lymphatic territories which were called liposomes, each with its own of pool lymphatic vessels and draining lymph nodes. In dogs, Suami et al., demonstrated the presence of ten lymphatic territories (22); the same team demonstrated the presence of eight lymphatic territories in rabbits.

The superficial lymphatic network is well-represented in both animals and humans, but compared to man in animals the deep lymphatic network is less studied (24).This pattern is in contrast with descriptions related to the lymphatic drainage of the healthy mammary glands in female dogs. The presence of two lymphatic networks was demonstrated: a superficial lymphatic network that collects lymph from the skin and subcutaneous tissue and a deep lymphatic network draining the profound parenchyma of mammary glands (2,17,18). Between the two networks there are two types of anastomoses: one at the areola and another on the periphery of the mammary gland (18).

Lymphatic vessels in animals have been emphasized mostly in pathological conditions related to the presence of lymphedema, inflammatory diseases and lymphatic metastasis (4,7,11,13,14,22).

The superficial lymphatic drainage in both animals and humans is highly variable due to the atypical direction to the unexpected lymphatic center which drained the certain territories in specific condition. The main cranial superficial drainage lymph centers in animals include: parotidian lymph center, mandibular, cervical superficial and axillary lymph center. Caudally, the most important lymph centers that drain the superficial structures are the inguino-femoral lymph center


100

(superficial inguinal) and popliteal lymph center (7,12,13). Due to the easy approach and their involvement in pathology these lymph centers were most often investigated.

Lymphatic system involvement in tumor metastasis

The knowledge regarding the lymphatic drainage, the path and the corresponding lymph nodes of various territories gains a substantial improvement due to the sentinel lymph node concept. This concept has changed the old theories concerning the delimitation of lymphatic territories and lymphatic drainage in certain conditions. Lymphatic vessels that pass the stated boundaries of lymphatic territories in cutaneous melanoma and unexpected locations of SLN (sentinel lymph node) were demonstrated. In animals the relatively few reports existing related to the lymphatic drainage in different pathologies leading to underestimation of clinical importance of detecting SLN and its evaluation. Herring (2002) studying oro-facial tumors in dogs concluded that the mandibular lymph nodes are not the only nodes which drain the oral carcinoma, but the parotidian lymph nodes or even the medial retropharyngeal lymph nodes could be the sentinel lymph nodes of these tumors(7).

The oral melanomas of dogs metastasize through lymphatic vessels in the closer regional lymph nodes of the facial region, from here, following lymphatic ways the tumoral cells spread to other distant locations (7,12). The most frequently involved are the mandibular lymph nodes, the next station being the deep cranial cervical lymph nodes followed by drainage in tracheal trunk. The presence of deep cranial cervical lymph nodes is variable in dogs; in this condition the direct drainage into the tracheal trunk is frequent.

However, in animals the most studied lymphatic drainage is the lymphatic drainage of the mammary glands in female dog. This species was often an animal model in studies related to the mammary drainage of women breasts. In this regard numerous studies have concluded that the mammary gland drainage in female dog has two directions: cranial or caudal in relation with studied mammary gland topography (2,18). It was demonstrated that cranial thoracic mammary glands (T1) and caudal (T2), along with cranial abdominal mammary gland (A1) are drained by axillary lymph center (the proper axillary lymph nodes and accessories) (17); caudal abdominal mammary gland (A2) along the inguinal mammary gland (I) are drained by the superficial inguinal lymph nodes (18); in most cases cranial abdominal mammary gland (A1) has two-way drainage direction, sometimes simultaneously, cranial and caudal (2). Also, an atypical drainage in cranial direction is achieved through the cranial sternal lymph nodes orcervical superficial lymph nodes (17, 18); caudal drainage can be achieved by popliteal lymph nodes (2,4)in some pathological situations, or even the medial iliac lymph nodes simultaneously, thus explaining the direct metastasis into the abdominal cavity (4,13,14).

Regarding the presence of lymphatic connections between the mammary glands, lymphatic vessels passing the white line were demonstrated (13,18). This


101

vessels, made the connections between contra-lateral mammary glands and in pathological condition between the contra-lateral lymph nodes too. From all mentioned above the great variability of lymphatic drainage of mammary glands is obvious hence the need of lymphatic mapping assessment when in presence of mammary gland tumors (4,18). From the perspective of an anatomist, identification of the first drainage stations in mammary gland neoplasia in the female dog starts from normal drainage variants listed above.

Another subject of debate is location of the injection sites of dyes, chemicals or radiological contrast agents in order to identify the sentinel lymph nodes in all malignancies that metastasize through the lymphatic system. Of course, the most studied cancers which metastasize through the lymphatic vessels are melanomasand mammary gland tumors, both in man and animals. Several variants of injection sites were proposed - in mammary gland neoplasia; subareolar, intraparenchymal, peritumoral or intratumoral injection. It was found that the application of two complementary techniques has improved ability to detect SLN (4). Even so, false negative results are in appreciable proportion (up to 10-17%). Each method has specific benefits: i.e. deep injection has the ability to detect deep lymph nodes or atypical paths of lymphatic vessels which in normal conditions are missing. On the other hand superficial injection has the advantage of fast detection of lymphatic drainage due to the fast takeover of identification agent and is not dependent on the palpable tumor (4).

Modern imaging methods and non-invasive assessment of the lymphatic system in animal models

In veterinary medicine non invasive identification and evaluation of lymph nodes and lymphatic vessels has gained favor in recent years due to the use of animal models in research related of lymphatic pathology and metastasis (1,11). Conventional ultrasound technique is available and recommended for initial evaluation of lymph nodes (3). The grey scale ultrasound monitored parameters shape, size, echogenicity, echostructure capsule pattern and delimitation, hilum echogenicity and provides important information in the lymph nodes description. But like CT or MRI, which reveal the clear lymph nodes topography, conventional US cannot make a distinction between normal and pathological lymph nodes especially in differentiation of pathological process. In humans lymph nodes which are less than 5mm in dimension, are hardly identifiable and pathology in these situations cannot be excluded (1). Furthermore, in animals the size cannot be a differentiation criterion because there is no standardization of this parameter of each species or breeds within the same species. The shape is questionable too as long as in some animals rounded shape of lymph nodes is normal. The presence of a capsule more or less regular and absence of a hyperechogenic hilum are not sufficient features to classify a lymph node for certain pathology. Using conventional ultrasound the aims of the studies in dogs and mice besides the lymph nodes description are the accurate identification of lymph node topography


102

in order to perform lymph node biopsy. It seems that yet the histopathological examination remains the "gold standard" in assessing lymph node status.

When quantifying lymph nodes vasculature Doppler techniques bring important data on the presence, distribution and appearance of blood vessels in both normal but especially in pathological lymph nodes (3). Using Color Doppler technique normal vasculature distribution from the hilum toward to the capsule, in contrast with metastatic lymph nodes vascularization (peripheral arterial type or mixed pattern) has been described (3). Power Doppler technique accurately identifies the vascular signal in small blood vessels of lymph nodes.

The appearance of ultrasound contrast agents consisting of small micro-bubbles (4-7 microns)has revolutionized ultrasound techniques and represented a great progress into lymph nodes assessment. Along with CEUS, (contrast enhanced ultrasound) the real time elastography can be considered a true breakthrough in differentiating normal from pathological lymph nodes. CEUS exploiting the differences between the characteristics of blood flow in normal and pathological tissues in lymph nodes identification has found a special application revealing vascular changes of small vessels, avascular areas being interpreted as a sign of malignant infiltration (12,21). Peritumoral administration of contrast agent in spontaneous and induced melanoma in pigs identified with high accuracy both lymphatic vessels and lymph nodes that drain the skin tumor basin. Thanks to the SonoVue contrast agent tropism for lymphatic endothelium this technique was extrapolated being able to identify both lymphatic path and sentinel lymph nodes in mammary gland tumors in female dog (21).

Real time elastography has opened a new perspective in lymph nodes evaluation by quantifying the degree of rigidity of lymph node parenchyma (10). The elastography is based on the principle that compression of the tissue induces tension and displacement, which is lower compared to rigid structures in soft tissues and malignant tissues that are generally harder than normal structures. To each degree of rigidity a certain color is assigned; in order of increasing rigidity, red, yellow, green and blue. Related to the degree of strain and the proportion that each color shades the lymph node the scores were assessed to each situation (scores from 4 to 8) to differentiate benign from metastatic lymph nodes (10). SECTION II

Anatomical particularities of digestive system in animal models

Advanced research on the digestive tract of mammals caused a veritable explosion of information leading to the formulation of new concepts related to digestive strategies of vertebrates (6,9).

One of the major advantages of phylogenetic evolution of herbivores is developing a highly efficient masticatory apparatus. The temporomandibular joint ofLagomorphs and Rodents is situated dorsal to the occlusal surface of the premolars and molars allowing high degree masticatory movements such as forward and backward movements, lateral movement of mandible and even circular


103

movements. Lagomorphs differ from Rodents by having two sets of upper incisors and a more pronounced astigmatism, so only a part of the upper molars are in contact with the lower ones at a time (16).

Herbivores digestive strategy is based on microbial population in the gut under the influence of which the fermentative processes take place (6,9,15,19). Depending on the location in which fermentation takes place the herbivores are classified in fore-gut fermenters (as large herbivores) and hind gut fermenters - small herbivores like lagomorphs (domestic rabbits, hares) or rodents (guinea pigs, chinchillas). In these circumstances herbivores get most of the nutrients due to anatomical particularities of the digestive tract capable of retention and microbial fermentation in different sections properly developed of digestive system (stomach, cecum or colon).

Rodents and lagomorphs stomach shows no distinctive anatomical features, being unilocular with a strong gastroesophageal barrier that prevents vomiting, of a well developed fornix and pyloric antrum in rabbits and guinea pigs compared with chinchillas which show an obvious duodenal ampulla (15). But the main anatomical feature directly related to digestive strategy of small rodent and lagomorphs is the presence of an enlarged cecum, the main site of microbial fermentation. Development of voluminous cecum with the presence of well developed vermiform appendix and the presence of internal mucosal folds but more specific the spiral fold is the main distinctive anatomical feature of rabbit cecum (19). It can be concluded that the digestive physiology is directly related to the hind-gut morphology.

Another aspect of animal digestive strategy used as experimental models is based on colonic separation mechanism (6,9,19). This mechanism returns nutritional liquids, small particles, bacteria into the cecum allowing the passage through the colon distal of coarse feed. Two types of colonic separation mechanisms depending on their coordinating structure have been described: the "wash back mechanism" in rabbits and “mucus trap mechanism" in rodents.

Conclusions

Developing an animal model in lymphatic system research required a proper knowledge of the morphology of the system of the species directly involved in the investigation protocol.

In the presence of mammary gland tumors combining two techniques subareolar and peritumoral injection could accurately identify lymph nodes that drain the neoplastic mammary gland.

Anatomy of the digestive system of rodents and lagomorphs is extremely complex especially the components that define digestive strategy.The possibility of low nutrient retention due to reduced capacity of the digestive tract is countered by colonic separation mechanism.


104

Choosing a species as animal model must take into account the anatomical particularities that make it suitable to the research hypothesis on the one hand and on the other hand the anatomic digestive particularities and digestive physiology are just as important in the proper management during the research

Acknowledgement

This paper was published under the frame of European Social Fund, Human Resources Development Operational Programme 2007-2013, project no. POSDRU/159/1.5/S/136893

References

1. Beukers, M., Grosso, F. V., &Voorhout, G., Computed tomographic characteristics of presumed normal canine abdominal lymph nodes. Veterinary Radiology & Ultrasound, 2013, 54(6), 610-617.

2. Florin Stan, Gudea, Al., Baba, A.I., Lymphatic drainage of the first abdominal mammary gland in bitch-implications in pathology, Bulletin USAMV 2/2005, seria Medicină Veterinară, p.299-303.

3. Florin Gheorghe Stan, Power Dopler ultrasonography vs Color Dopler of the Sentinel Lymph Mammary Glands at Female Dog, Bulletin UASVM, Veterinary Medicine, 2010, 67 (1), 298-304

4. Florin Stan, Corelation Beetwen Subareolar And Peritumoral Blue Dye Injection To Identify Sentinel Lymph Nodes In Canine Mammary Glands Neoplazia, Lucrări Ştiinţifice, seria Medicină Veterinară, Iasi, 2012, 55(1-2),125–132

5. Florin Stan, Topographical anatomy of guinea pigs kidneys, Lucrări Ştiinţifice Medicină Veterinară Vol. XLVII(1), 2014, Timişoara, 114-123

6. Franz, R., M. Kreuzer, J. Hummel, J-M Hatt, M., Clauss Intake, selection, digesta retention, digestion and gut fill of two coprophageous species, rabbits (Oryctolaguscuniculus) and guinea pigs (Caviaporcellus), on a hay-only diet, J Anim Physiol Anim Nutr (Berl), 2011, 95(5), 64–570.

7. Herring, E.S., Smith, M.M., Robertson, J.L., Lymph node staging of oral and maxillofacial neoplasms in 31 dogs and cats. Journal of Veterinary Dentistry, 2002, 19, 122–126.

8. Kerjaschki, D., The lymphatic vasculature revisited. The Journal of Clinical Investigation, 2014, 124(3), 874–877.

9. Kohles, M., Gastrointestinal anatomy and physiology of select exotic companion mammals. Vet Clin North Am Exot Anim Pract; 2014, 17(2),165-78.

10. Lenghel, L.M., Bolboaca, S.D., Botar-Jid, C., Baciut, G., Dudea, S.M., The value of a new score for sonoelastographic differentiation between benign and malignant cervical lymph nodes. Med Ultrason, 2012, 14, 271-277.


105

11. Li, L., Mori, S., Sakamoto, M., Takahashi, S, Kodama T., Mouse Model of Lymph Node Metastasis via Afferent Lymphatic Vessels for Development of Imaging Modalities.PLoSONE, 2013, 8(2).

12. Lurie, D.M., Seguin, B., Schneider, P.D., Verstraete, F.J., Wisner, E.R., Contrast-assisted ultrasound for sentinel lymph node detection in spontaneously arising canine head and neck tumors. Invest Radiol., 2006, 41(4), 415-21.

13. Pereira, C.T., Rahal, S. C., De CarvalhoBaliero, J. C., Ribeiro A. A. C., Lymphatic drainage on healthy and neoplastic mammary glands in female dogs, Can it really be altered? Anat. Histol. Embryol., 2003, 32, 282–290.

14. Sorenmo, K.U, Rasotto, R., Zappulli, V., Goldschmidt, M.H., Development anatomy, histology, lymphatic drainage,clinical features, and cell differentiation markers of canine mammary gland neoplasms.VetPathol, 2011, 48, 85–97.

15. Stan, F., Comparative study of the stomach morphology in rabbit and chinchilla, AgroLife Scientific Journal, 2013, Vol. 2 Issue 2, 73-78.

16. Stan, F., Comparative Morphological Study of Oral Cavity in Rabbits and Guinea Pigs. Scientific Works. Series C. Veterinary Medicine, 2014, Vol.LX(1) 27-32.

17. Stan, F., Study of the Lymphatic Vascularisation of the Cranial Thoracic Mammary Gland (T1) in Bitch, BUSAMV, Cluj-Napoca Veterinary Medicine, 2009, vol 66(1), p.107-113.

18. Stan, F., Aspectemorfologiceprivindvascularizaţialimfatică al glandeimamare la căţea, Lucrări Stiintifice Universitatea de Stiinte Agricole Si Medicină Veterinară “Ion Ionescu De La Brad” Iasi, 2002, vol 51(10) Medicină Veterinară partea 1/2 p.177-182.

19. Stan, F., Anatomical Particularities of the Cecum in Rabbits and Chinchillas. BUSAMV Veterinary Medicine, 2014, 71(2), 406-412.

20. Stan, F., Morphological study of lymphatic drainage and lymph nodes of mammary glands in doe, BUSAMV Veterinary Medicine, 2014. 71(1), 213-219.

21. Stan, F., Badea, R., Morphological Identification of Lymph Node Vasculature Using Contrast Enhanced Ultrasonogaphy (CEUS) BUSAMV Veterinary Medicine, 2012, 69(1-2).197-203

22. Suami, H., Yamashita, S., Soto-Miranda, M.A., Chang, D.W., Lymphatic Territories (Lymphosomes) in a Canine, An Animal Model for Investigation of Postoperative Lymphatic Alterations. PLoS ONE, 2013, 8(7), e69222.

23. Suami, H., Chang, D.W., Matsumoto, K., Kimata, M. Y., Demonstrating the lymphatic system in rats with microinjection. Anat Rec, 2011, 294, 1566–1573.

24. Suami, H., Shin, D., Chang, D.W., Mapping of lymphosomes in the canine forelimb, comparative anatomy between canines and humans. PlastReconstr Surg., 2012, 129(3), 612-20.


106

FOCUS GROUP (TEACHERS) RESEARCH IN THE FRAME OF PROJECT ”ADOPTING OF PROBLEM-BASED LEARNING INTO

VETERINARY NURSE PROFESSIONAL TRAINING”

NARCISA MEDERLE, MIRELA SAMFIRA, GEORGETA RAȚĂ

Banat‟s University of Agricultural Science and Veterinary Medicine, “King Mihai I of Romania” from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street,

No 119, Timisoara, Romania E-mail: [email protected]

Summary

The main aim of the project is to adopt innovative instructional strategy – Problem-based learning – into programme of Veterinary Medicine. Necessity of Focus group research appears in order to define the most relevant learning content for application of problem based learning instructional strategy on the one hand and to hear the voice of the employer or Veterinary nurse practitioner – on the other. Also it‟s important to reflect on tutors‟ (teachers) and students‟ attitudes concerning Problem-based learning (PBL) and Problem-based teaching (PBT) instructional strategies. Focus group was composed of 10 teachers of the Faculty of Veterinary Medicine Timisoara who responded to a total of 10 questions. The conclusions is that PBT/PBL facilitators (teachers) need proper training in the application of this method in class/laboratory despite the fact that they already sue it without being aware of it, that they agree PBT/PBL can be applied in the teaching of their subjects, and that they identify the advantages and disadvantages of PBT/PBL correctly. They also claim adopting PBT/PBL in veterinary medicine would be hindered by two facts: students no longer read in the process of learning; there is inertia in our educational system.

Key words: project, focus group, professional training

Problem-based learning is an innovative instructional strategy which can

be applied into programme of Veterinary Medicine (1,3). This implementation represents the main aim of a project entitled ”Adopting of Problem - Based Learning into Veterinary Nurse Professional Training”. The project started in September First 2014 and will finish in September First 2016. The field of the project is Strategic Partnerships for Vocational Education and Training. The partners are – University of Applied Sciences, Vilnius, Lithuania; Banat‟s University of Agricultural Science and Veterinary Medicine, “King Mihai I of Romania” from Timisoara, Romania; Abivet, Rome, Italie; European Center for Quality, Sofia, Bulgarie. One of the main actions of the project was to organize Focus Group teachers, Focus Group students and Focus Group veterinary nurse practinioners. Necessity of Focus group research appears in order to define the most relevant learning content for application of problem based learning instructional strategy on the one hand and to hear the voice of the employer or Veterinary nurse practitioner – on the other. Also it‟s important to reflect on tutors‟ (teachers) and students‟


107

attitudes concerning Problem-based learning (PBL) and Problem-based teaching (PBT) instructional strategies (2, 4, 5, 6).

Methodology

Project‟s Focus Group research methodology consists from the main

components of the research: aims, objectives, target group, focus groups questions, date, implementation time, discussions marking template (7, 10).

Aim of focus group research - finding out the most favourable conditions (in terms of attitudes, problems areas and disciplines) for realization Problem-based learning strategy in educational practice (8, 9).

Objectives of focus group research (6, 9): 1. Find out the most relevant problematic areas in the sphere of

Veterinary Nurse professional practice; 2. Define the most relevant disciplines/areas for implementation of

Problem-based learning instructional strategy; 3. Find out attitudes of tutors and students concerning

implementation of Problem-based learning strategy in educational practice.

Target groups of focus group research: Owners of veterinary clinics, Veterinary nurses, Veterinary practitioners, Experts from Governmental organizations connected to veterinary nurse professional training, Academicians, Lecturers of Veterinary medicine, Learners of Veterinary medicine.

Key question for focus group teachers were: 1. Have you ever heard definition Problem-based learning? 2. How would

you define problem-based learning instructional strategy? 3. Do you think Problem-based learning would be suitable to implement in your discipline? 4. Why do you think so? 5. What advantages of problem-based learning you would define? 6. What disadvantages of Problem-based learning would you define? 7. What disciplines in Veterinary medicine are the most suitable for implementation of Problem-based learning instructional strategy? Why? 8. What disciplines in Veterinary medicine are not suitable to apply Problem based learning strategies? Why do you think so? 9. Would you like to try to implement problem-based learning in your discipline? Why? 10. What would be the reaction of your colleagues if you apply Problem-based learning in your discipline? Why do you think so?

Focus group research dates and time: Between 2014 December 10 –

2015 February 28; Discussions time – up to 2 hours.


108


Question 1. Responses were: Seven of the ten respondents admitted they have heard about PBT/PBL and

even advance definitions of PBT/PBL:

- 3 respondents gave confusing definitions; - 2 respondents defined it as a teaching method based on interaction; - 1 respondent defined it as a teaching method based on creativity; - 1 respondent defined it as a teaching method based on dialogue; - 1 respondent defined it as a teaching method based on prior knowledge.

Question 2. Responses were: Nine respondents answered this question but only 4 of them supplied

“definitions” of PBT/PBL (which they had already done previously):

- It is a teaching method that requires prior knowledge; - It is a teaching/learning method for practical issues; - It is a challenging teaching/learning method for both teachers and students,

objecting that:

- Students should at least read before attending practical courses; - Students no longer read; - Romanian VM higher education should follow the American model where

PBT/PBL is used; - Foreign students should comply with our teaching/learning methods and

requirements;

- Foreign students seem to be more interested in learning; - Foreign students do not read before academic/practical courses; - Few students read.

Question 3. Responses were: All the respondents said there is hardly one subject area that cannot be

taught/learnt from a problem-based methodology point of view; their subject areas are:

- Anatomy; - Bird pathology ; - Dermatology; - Genetics & reproduction; - Infectious diseases; - Medical pathology; - Parasitology; - Semiology ; - Toxicology.

Question 4. Responses were:

- Because it is fundamental is diagnosing; - Because of the practical character of veterinary medicine.

Question 5. Responses were:


109

Advantages:

- It allows better evaluation of students‟ achievements; - It changes mentality; - It encourages individual study; - It establishes a good teacher-student relationship; - It facilitates learning; - It helps correlate academic course and practical work; - It helps students consolidate their knowledge and skills; - It is challenging; - It is interactive; - It makes students appeal to their knowledge; - It makes students think; - It makes teachers learn as much as their students.

Question 6. Responses were: Disadvantages:

- It disadvantages shy students; - It is time-consuming; - Students do not know the terms; - Students do not read.

Question 7. Responses were: The respondents answered PBT/PBL can be used more or less in the

teaching/learning of almost all VB-related subject areas because they have a practical side.

Question 8. Responses were: The respondents answered PBT/PBL can be used more or less in the

teaching/learning of almost all subject areas except for:

- Biophysics; - Biochemistry; - The history of veterinary medicine, because of the nature of these subject

areas. Question 9. Responses were: Almost all the respondents answered YES, because:

- It would be beneficial; - It would be welcome; - It would work well; - There is no veterinary medicine teaching/learning without it. - One respondent said YES, but objected that there is a lot of inertia in

teaching/learning. Question 10. Responses were: Almost all the respondents answered they DID NOT KNOW, but they said:

- Everybody applies PBT/PBL without even realising it; - It has already been implemented; - It is already used by the students.


110

It is interesting to have a look at the participation rate of the teacher-respondents (Figure 1): few answers in TQ1 to TQ4 and TQ7-TQ8 and full participation in TQ5-TQ6 and TQ9-TQ10.

Fig.1. Teacher participation rate in the focus group

Only 40% of the teachers gave good definitions of PBT/PBL (identifying such features as creativity, dialogue, interactivity and prior knowledge), while 30% gave wrong definitions and 30% gave no definition at all answering TQ1 (Have you ever heard about PBT/PBL?).

As for TQ2 (How would you define PBT/PBL instructional strategy?), only three respondents “defined” PBT/PBL instructional strategy mentioning the necessity of prior knowledge, the practicality of the method and the fact that it is a challenging method.

In response to TQ3-TQ4 (Do you think PBT/PBL could be implemented in your discipline? Why?), representatives of 9 subject areas stated PBT/PBL could be implemented in the teaching of their subjects, arguing that it is fundamental in diagnosing and that veterinary medicine has a practical character.

As far as TQ5 (What advantages of PBT/PBL you would define?) is concerned, the teachers identified advantages for both the students and the teachers, as well as common advantages.

In TQ6 (What disadvantages of PBT/PBL would you define?) again, the teachers identified disadvantages for both the students and the teachers, as well as common disadvantages.

TQ7 (What Veterinary medicine subjects are the most suitable for PBT/PBL instructional strategy? Why?) gathered together all the respondents who gave the same positive answer, but could not supply more than one reason.


111

The corollary question, TQ8 (What disciplines in Veterinary medicine do not match PBT/PBL strategies? Why?) again got proper answers and reasons – this time, from the perspective of veterinary nurses.

As for TQ9 (Would you like to try to implement PBT/PBL? Why?), all respondents agreed they would like to implement PBT/PBL but admitted it could be difficult to do it.

TQ10 (What would be the reaction of your colleagues if you applied PBT/PBL? Why?) did not get proper answers because it concerned the respondents‟ colleagues.

Conclusions

PBT/PBL facilitators need proper training in the application of this method

in class/laboratory despite the fact that they already sue it without being aware of it, that they agree PBT/PBL can be applied in the teaching of their subjects, and that they identify the advantages and disadvantages of PBT/PBL correctly.

Adopting PBT/PBL in Veterinary Medicine would be hindered by two facts: students no longer read in the process of learning; there is inertia in our educational system.

References

1. Chiang, V.C., Chan, S.S., An evaluation of advanced simulation in nursing: a mixed-method study, Collegian, 2014, 21(4), 257-65.

2. Samples, J., Marshall, J., Midwifery Basics: Mentorship: 2. Skills to facilitate learning in clinical practice, Pract Midwife, 2014, 17(10), 33-4,36-7.

3. Campos, L.R., Ribeiro, M.R., Depes, V.B., Autonomy of nursing undergraduate student in the (re)construction of knowledge mediated by problem-based learning, Rev Bras Enferm., 2014, 67(5), 818-24.

4. Cónsul-Giribet, M., Medina-Moya, J.L., Strengths and weaknesses of Problem Based learning from the professional perspective of registered nurses.- Rev Lat Am Enfermagem, 2014, 22(5), 724-730.

5. Tovar, E.G, Warshawsky, N., Use of a problem-based learning exercise to teach the lean 8-step problem-solving method. - Nurse Educ., 2015, 40(2), 101-4.

6. Navarro, H.N., Zamora, S.J.,The opinion of teachers about tutorial problem based learning, Rev Med Chil., 2014, 142(8), 989-97.

7. ***http://www.unimaas.nl/pbl/.

8. ***http://edaff.siumed.edu/dept/index.htm.

9. ***http://www.uchsc.edu/primary/pbl.htm.

10. ***http://medworld.biomed.hawaii.edu/jabsom_mw.html.

http://www.ncbi.nlm.nih.gov/pubmed/25632722













http://www.unimaas.nl/pbl/

http://edaff.siumed.edu/dept/index.htm

http://www.uchsc.edu/primary/pbl.htm

http://medworld.biomed.hawaii.edu/jabsom_mw.html


112

RESEARCH ON THE CORRELATION BETWEEN WATER TEMPERATURE AND HEMATOLOGICAL PARAMETERS OF FISH

IN A TROUT FARM IN VÂLCEA DISTRICT

ELENA MITRĂNESCU, L. TUDOR, A. LĂTĂREŢU

University of Agronomic Sciences and Veterinary Medicine of Bucharest, Faculty of Veterinary Medicine, 105, Splaiul Independentei, District 5, 050097, Bucharest,

Romania E-mail: [email protected]

Summary

Increased demand for fish consumption intensive exploitation of trout turned into a

necessity that can be supported by a correlation between the quality of living environment and their health status correlated with density, optimum transport and proper handling. In this research were conducted in a trout farm in Vâlcea District, where was monitored water temperature for a period of six months (in summer and winter) and blood samples were taken from trout, which were determined: the total number of red blood cells, the hematocrit and leukocytes (neutrophils, lymphocytes, monocytes and eosinophils). The methods used were those recommended by the Council for Standardization in Hematology and the results were compared with reference values from the literature, were processed and interpreted statistically.

The dynamic evaluation of main parameters of blood, was synthetic and comparative assessment and follows that: the average values of dominants of blood erithrom level (erythrocytes and hematocrit) and white line (lymphocytes, monocytes and eosinophils) were significantly higher in terms statistically in the winter months compared with those determined in the summer months, indicating haemoconcentration correlated with physical activity of fish, water temperature and ambient temperature; mean values of neutrophils were significantly higher in the summer months compared to those determined in winter, which indicates a particular type response to the action of various factors and / or environmental aggression factors.

Key words: water, trout, blood samples, haematological parameters

Scientific research conducted in recent decades have led to the conclusion

accepted by most experts in the field of animal welfare and protection of the fish, mammals and birds as are sentient beings capable of living positive and negative mental states. In the context of meeting the requirements of fish of increasingly large market their intensive has become a necessity that can be provided by a correlation between water quality, health, and proper handling of fish density.


113


In a trout in Valcea county was monitored for two years three months in summer and winter water temperature. The blood samples were taken from trout of which were determined following hematological parameters: total number of red blood cells, hematocrit and leukocytes (neutrophils, lymphocytes, monocytes and eosinophils). Blood sampling for examination hematologic were made in containers BD Vacutainer EDTA, using 1 ml syringe with 23 G needle through the lateral approach and ventral caudal vessels of trout. Methods for determining haematological parameters were those recommended by the Standards Council hematology respectively, total red cell counting camera (BURKER Turkey) (6); Using Hettich hematocrit rotor and centrifuge for five minutes at 12,000 revolutions / minute and leukocytes by drawing on smears on microscope slides and stained by the method (Diff-Quick) Romanowsky. The results were compared with reference values from the literature and were processed by the arithmetic mean, median, standard deviation and interpreted statistically by Mann-Withney and Pearson.


Analyzing the results obtained are significant differences in statistically

water temperature in the two seasons. This was demonstrated by the coefficient α = 0.05 U calculated as less than zero as the critical U 5. Table no. 1 presents the results of the monthly average, median and standard deviation of trout water temperature.

Table 1

Monthly average values, arithmetic mean, median and standard deviation of the water temperature seasons

Specification Winter Summer

Dec 2010

Jan 2011

Feb 2011

Dec 2011

Jan 2012

Feb 2012

June 2011

July 2011

Aug 2011

June 2012

July 2012

Aug 2012

Temp monthly average

4 3 5 5 3 3 17 19 20 18 20 19

Average / season

3.83 18.83

Median / season

3.5 19.0

Standard deviation / season

0.98 1.36

Reference limits after Man .C and A. Man for trout 3-20 OC


114

In aquaculture water temperature influences the dissolved oxygen concentration, ammonia ionization, as well as the process of photosynthesis and metabolism of fish fertility (5, 13). When the water temperature rises above the permissible limits is an increase of toxicity of contaminants dissolved in water (17, 21). An increase in water temperature over 20 °C for salmonids may cause a decrease in metabolic processes and consumption of food (13). A decrease in water temperature below 3 °C may promote the occurrence of epidermal hyperplasia in the fins of fish (17, 22). Sudden fluctuations in water temperatures are harmful to fish generating heat shock cardiac muscle paralysis followed by death (13). Table no. 2 presents the results of haematological examination of fish.

Table 2

Monthly average values of hematological parameters in trout

Season Parameters

Erythrocytes

no. x Hematocrit

(%) Lymphocytes

(%) Neutrophils

(%) Monocytes

(%) Eosinophils

(%)

December 2010 1.14 33.5 91.0 4.5 3.8 0.7

January 2011

1.11 34.2 91.0 4.5 3.4 0.3

February 2011 1.09 34.9 89.4 6.1 3.9 0.7

December 2011 1.19 33.0 90.0 5.7 3.7 0.6

January 2012

1.22 34.4 89.7 6.3 4.4 0.3

February 2012 1.17 33.6 89.9 5.4 4.3 0.7

June 2011

1.23 33.7 89.6 6.4 3.6 0.4

July 2011

1.22 34.3 89.5 6.5 3.6 0.4

August 2011

0.98 28.6 89.6 6.2 3.6 0.6

June 2012

1.18 28.7 89.7 6.0 4.0 0.4

July 2012

1.06 28.4 88.8 6.4 4.1 0.7

August 2012

1.14 30.5 89.3 6.2 4.0 0.5

Setpoint after Wedermayer and Nelson

(1975) Miller (1983)

Svabodova and B. Vykusova

(1991)

0.77-1.66 24-43 76-97.5 2-10 3-5 0-0.5

By analyzing the dynamics of the 6 haemodynamic parameters namely:

erythrocytes, hematocrit, lymphocytes, neutrophils, monocytes and eosinophils, months and seasons, the following conclusions:


115

- Arithmetical mean values of erythrocytes are higher in the winter months, respectively, than those of 1.18 to 1.12 during the summer months, and the value calculated for α = 0.05 U 18 U lower than the critical factor 23 indicates a statistically significant difference between the values of erythrocytes in winter compared to summer values of erythrocytes.

- Arithmetic mean hematocrit values are higher in winter months, respectively 33.93 from those in the summer months of 30.7, and the value calculated for α = 0.05 U, 8 times lower than the coefficient 23 U critic indicates a statistically significant difference between hematocrit values in winter versus hematocrit values in summer;

- Arithmetic mean lymphocyte values are higher in the winter season, ie from 90.18 to those summer months of 89.44, and the value calculated for α = 0.05 U of 4.5 lower than the coefficient 23 U critic indicates a statistically significant difference between the values of winter lymphocytes, lymphocytes from the values of the summer season;

- Arithmetic mean values of monocytes are higher in the winter season, ie from 3.86 to those summer months of 3.81, and the value calculated for α = 0.05 U is 19 less than the coefficient U critical 23 indicates a statistically significant difference between the values mononuclear winter to summer mononuclear values;

- Arithmetic mean eosinophil values are higher in the winter season, ie 0.55 to 0.50 those of the summer months, and the value U calculated at α = 15 is less than 0.05 coefficient U 23 critic, indicating a statistically significant difference between the values recorded during eosinophil winter season to season summer months;

- Arithmetic mean values of neutrophils, unlike the other five hematological parameters are higher in the summer months, 6.28 respectively than those in the winter months of 5.41 and coefficient values calculated from 4 to α U = 0, 05 is less than the critical value of 23 U coefficient, which indicates a statistically significant difference between neutrophil values recorded during the summer season to season winter months;

- Values outside the reference ranges were only two parameters, namely the erythrocytes for 8 samples, of which 4 samples values below lower limit of reference and 4 samples values above the upper limit of the reference range, and the 12 samples of which hematocrit at 7 samples values below the lower limit reference and a 5 sample values above the upper limit of the threshold reference.

Evaluation of blood parameters of fish is important in detecting diseases that affect blood cells in monitoring the progress of various diseases and therapeutic response to different treatments applied (4). Red blood cells, white blood cells, hematocrit, hemoglobin and red blood cell indices may be influenced by the environment including water quality (3, 9, 10, 19). The number of red blood cells, decreases in fish when they are exposed to high concentrations of nitrite, cadmium, lower temperatures and increases at higher water temperatures (1, 7, 12). The number of white blood cells decreases thymic destruction consecutive


116

prolonged exposure to fish in waters with high concentrations in nitrites, sulfates, low water temperature and increases with increasing water temperatures (1, 2, 7, 16). Hematocrit and hemoglobin decline when the fish are exposed to higher concentrations of ammonia, cadmium and increase when fish are exposed to the additional stress (8. 12, 13). Stress in fish cause lymphocytopenia and granulocytic (11).

Conclusions

The evaluation main parameters blood picture in dynamic synthetic and

comparative following conclusions were drawn: Arithmetical mean values of dominants erythromycin (erythrocytes and

hematocrit) and white line (lymphocytes, monocytes, eosinophils) were significantly higher in statistical terms in the winter months compared with those determined in the summer months, indicating haemoconcentration in correlation with the physical activity of individuals and the water temperature.

The mean values of neutrophils were significantly higher in the summer months compared with those determined in the winter months, which indicates a particular type of fish response to the action of various factors and / or processes aggressed character.

References

1. Bozorgnia, A., Alimohammadi, R., Hosseinifard, M., Acute effects of

different temperature in the blood parameters of common carp (Cyprinus carpio), 2

nd International Conference on Environmental Science and

Technology, IPCBEE, 2011, vol 6. 2. Bowden, T., Cook, P., Rombout, J., Development and function of the

thymus in teleosts, Fish & Shelfish Immunology, 2005, vol. 19, p. 413-427. 3. Bruno, D., Nephrocalcinosis, Aquaculture information series, 1996, vol. 16. 4. Campbell, T., Ellis, K., Avian & exotic animal hematology & cytology,

Blackwell Press, Iowa, 2007. 5. Colt, J., Tomasso, J., Hatchery water supply and tratment, Fish Hatchery

Management, 2001, vol 2., p. 91-186. 6. Curca, D., Fiziopatologie, lucrari practice si protocoale experimentale, editia

a II a, Ed. Printech, 2005. 7. Das, P., Ayyappan, S., Jena, J., Das, B., Effect of sublethal nitrite toxicity

on the haematological parameters of fingerlings of rohu, Labeo rohita, Indian J. Fish, 2004, vol. 51, p. 287-294.

8. El-Sherif, M., El-Feky A., Effect of ammonia on nile tilapia (O. Niloticus) performance and some haematological and histological measures, 8

th

International Symposionum on Tilapia in Aquaculture, 2008.


117

9. Fazio, F., Marafioti, S., Filiciotto, F., Buscaiono, G., Panzera, M., Faggio, C., Blood hemogram profiles of farmed onshore and offshore gilthead sea bream (Sparus aurata) from Sicily, Italy, Turkish Journal of Fisheries and Aquatic Sciences, 2013, vol. 13, p. 415-422.

10. Gabriel, U., Ezeri, G., Opabunmi, O., Influence of sex, source, health status and acclimation on the haematologz of Clarias gariepinus (Burch 1822), African Journal of Biotechnology, 2004, Vol 3, p. 463-467.

11. Hrubec, T., Smith, S., Hematology of fishes, Schlam‟s Veterinary Hematology, 6

th Edition, Wiley – Blackwell publishing, 2010.

12. Kaoud, H., Zaki, M., El-Dahshan, A., Saeid, S., El Zorba, H., Amelioration the toxic effects of cadmium-exposure in Nile Tilapia (Oreochromis Niloticus) by using Lemna gibba L, Life Science Journal, 2011, Vol. 8.

13. Leonard, J., McCormick, S., Changes in haematology during upstream migration in American shad, Journal of Fish Biology, 1999, vol. 54, p. 1218-1230.

14. Man, A., Man, C., Igiena piscicolă, Editura Risoprint, Cluj – Napoca, 2006. 15. Miller, W., Hendricks, A., Cairns, J., Normal ranges for diagnostically

important hematological and blood chemistry characteristics of rainbow trout (Salmo gairdneri), Can. J. Fish Aquat. Sci., 1983, vol. 40, p. 420-425.

16. Mishra, S., Srivastava, A., Haematology as an index of sublethal toxicity of zinc in a fresh water teleost, Bull. Environm. Contam. Toxicol, 1979, vol. 22, p. 695-698.

17. Roberts, R., The effects of temperature on diseases and their histopathological manifestations in fish. The Pathology of Fishes, p. 477-496, 1975.

18. Svobodová, Z., Vykusová, B., Haematological examination of fish, Diagnostics, prevention and therapy of fish diseases and intoxications, manual, 1991.

19. Vazquez, G., Guerrero, G., Characterization of blood cells and haematological parameters in Cichlasoma dimerus (Teleostei Perciformes), Tissue & Cell, 2007, vol. 39, p. 151-160.

20. Wedemeyer, G., Nelson, N., Statistical Methods for Estimating Normal Blood Chemistry Ranges and Variance in Rainbow Trout (Salmo gairdneri) Shasta Strain, Journal of the Fisheries Research Board of Canada, 1975, vol. 32, p. 551-554.

21. Wedemeyer, G., Physiology of Fish in Intensive Culture Systems, Editure Chapman & Hall, London, 1996.

22. Wendelaar Bonga, S., The stress response in fish, Physiological Reviews, vol. 7, p. 591-625, 1997.


118

METHODS AND PROCEDURES FOR HEART DECELLULARIZATION

A. A. MORVAY

1, CSILLA ZAMBORI

1, V. ORDODI

2, E. TIRZIU

3, V. PAUNESCU

2

1"Victor Babes" National Institute of Research and Development in Pathology

domain and Biomedical Sciences, Splaiul Independentei, no. 99-101, 050096 Bucharest, Romania

2University of Medicine and Pharmacy “Victor Babes” Timisoara, Department of

Functional Sciences 3Banat‟s University of Agricultural Sciences and Veterinary Medicine, King Michael

I of Romania, Calea Aradului, no. 119, Timisoara, Romania E-mail: [email protected]

Summary

Heart failure is the end-stage of many cardiovascular diseases and cardiovascular

disease is one of the leading causes of death in the Western world. Most of the synthetic grafts, made of bio-inert materials used as replacements of damaged valves and vessels, fail when it comes to biointegration. Over the past two decade‟s cardiomyoplasty, which involved administration of cells with regenerative properties, has been the aim of most research studies in heart regeneration. More recently, researchers are focusing on generating bioartificial hearts by decellularization and preservation of supporting structures in order to repopulate with new vascular and muscle tissue. Decellularization is a procedure which involves chemical, physical or enzymatic treatment of an organ or tissue from humans or animals to eliminate all resident cells in order to obtain an extracellular matrix (scaffold). The scaffolds obtained thought the decellularization process mimic nature‟s design to a degree that it can‟t be reproduced with any synthetic materials. The aim of this procedure is to obtain an intact extracellular matrix of an organ or tissue which will be used in regenerative medicine, transplantation and/or bioartificial organs. In this review, we examine the most frequently used methods and procedures for heart decellularization and latest achievements.

Key words: decellularization, recellularization, bioartificial heart, scaffold

Cardiac tissue engineering holds promising techniques for congenital heart

defects repairing, aortic valves replacing, restoring scarred miocardic tissue and eventually in the future even to create a transplantable whole heart from a patient‟s own stem cells (13). Until now, heart transplantation is the definitive treatment for end-stage heart failure, being limited by the lack of donors and waiting list mortality. Even if the heart transplant is successful, the recipients must undergo a lifelong immunosuppressant treatment. To solve these problems one potential and promising solution is the bioartificial heart construction, obtained by means of decellularization and recellularization (17). These advanced techniques of tissue engineering are using animal models to generate bioartificial heats by decellularization and repopulate them with vascular and muscle tissue. Decellularization is a procedure which involves chemical, physical or enzymatic


119

treatment of an organ or tissue from humans or animals to eliminate all resident cells in order to obtain an extracellular matrix (scaffold) (5). The scaffolds obtained thought the decellularization process mimic nature‟s design to a degree that it can‟t be reproduced with any synthetic materials (1). Decellularization techniques allows for the generation of complex three-dimensional scaffolds which preserves the macro and microstructure of the heart itself. The decellularized scaffold can then be recellularized by seeding it with cells, the goal being to build a functional organ which can be transplanted (18).

Methods and procedures for whole heart decellularization. To decellularize a whole-heart, several steps are required before and after

the actual procedure. The first step is the anesthesia of the animal, followed by systemic heparinization, then the canulation and harvesting of the heart. After canulation of the aortic artery retrograde perfusion of the heart is performed, this step marks the beginning of the decellularization process. Several methods can be applied to decellularize a whole heart, including physical, chemical and enzymatic processes. The most robust methods are the combination of these processes. The last step after the complete decellularization is the sterilization and the preservation of the intact scaffold. After finalizing the decellularization process, several methods can be applied in order to evaluate if the decellularization process is completed.

The most frequently used method for whole heart decellularization is the retrograde perfusion through the aortic artery via the coronary arteries (6, 11, 12, 16, 17). For the retrograde perfusion a modified Langendorff apparatus or a bioreactor is used, both consisting of a perfusion circuit and a pressure control module (16). Before the harvest and the perfusion of the heart, the animals (mouse, rat or pig) are anesthetized and a systemic heparinization is performed (13) or systemic heparinization is performed first fallowed by euthanasia of the animal (4). In a study performed by Weymann et al., the heparinization was performed only on the heart after harvest (16) and in another experiments the heart was harvested and ventricles were rinsed with water to remove coagulated blood (10, 14). The retrograde perfusion pressure applied to the heart harvested from rats ranges between 77.4-80mmHg (13) and 100 mmHg for the heart harvested from pigs (16, 17). The pressure control is very important because a higher pressure can damage the aortic valve or even rupture the artery or the left ventricle wall.

Before starting the retrograde perfusion the heart can be kept at -80 °C for storing and also this physical treatment leads to cell lysis (8, 14). Other physical methods used for tissue and organ decellularization involve sonication (2), pressure gradient system (16), agitation (10, 15), scraping and electroporation (18). However, care must be taken when using these methods because they can cause structural damage or fracture the scaffold (18).

The most frequently used chemical solutions in whole heart decellularization by retrograde perfusion are sodium dodecyle sulfate (SDS), Triton X-100, ethylenediaminetetraacetic acid (EDTA), sodium azide (NaN3) and


120

deoxycholic acid, alone or in various combinations with other substances in various concentrations (6, 8, 10, 11, 13, 14, 17). SDS solution is an anionic surfactant used for decellularization in concentration raging from 1% to 4% in deionized water or phosphate buffer solution (PBS). Triton X-100 is a non-ionic surfactant and is frequently used as 0.05-3% solution. EDTA is used as a ligand and chelating agent in 0.05% concentration. When using SDS and Triton X-100, caution must be taken due to cytotoxic concerns. In this regards, multiple rinsing steps are require to completely remove residual amounts of detergent (18).

Along with all the above mentioned chemical substances, biological agents (enzymes) can be used for whole heart decellularization. Among the most used enzymes in the decellularization process are trypsin, nucleases, collagenase, lipase and dispase. Trypsin has been extensively used as an enzymatic agent in tissue and whole organs decellularization including arteries, human amniotic membrane and hearts (7, 8). However, at high concentrations it may damage the extracellular matrix. Nonetheless, lower concentrations of trypsin can be used complementary with other detergents such as SDS and be highly effective to remove cellular contents (15). Enzymes can be highly specific for cell residues removal or undesirable scaffold constituents but complete cell removal by enzymatic treatment alone is difficult and enzyme residues may negatively influence recellularization or trigger an adverse immune response (3).

In table 1 the combination of several substances and procedures used in different studies for whole heart decellularization are listed. The actual decellularization process can last from a few hours to several days depending on the method used and the size of the heart. After decellularization the rinsing/washing step and the sterilization step are very important. The sterilization step is carried out by perusing a disinfection solution or a PBS solution containing antibiotics and antifungal agents. Lu et al., used a combination of peracetic acid (0.1%) and ethanol (4%) for 10 minutes for the disinfection of a mice decellularized heart (8). The washing step involves removing all the residual amounts of detergents and/or enzymes together with other components (cell fragments, DNA) of initial organ (17) and to neutralize previously used substances for disinfection (8). The most frequently used rinsing solution is PBS with or without added antibiotics. In a study performed by Ott et al., the whole heart scaffold was perfused for 124 hours with antibiotic containing PBS solution (11). After rinsing and disinfecting the decellularized heart, the scaffold can be used for further processes as recellularization, cytotoxicity assays, decellularization evaluation assays or can be stored in PBS at 4 °C and used later (8).

Evaluation of decellularized scaffold The evaluation of decellularized scaffold is an important step because

residual cellular material within the matrix may contribute to cytocompatibility problems in vitro and adverse host reactions in vivo upon reintroduction of cells (3). However, decellularization processes cannot remove all of cell material, but cell


121

components such as double-stranded DNA (dsDNA), mitochondria, membrane associated molecules such as phospholipids can be quantified (3). Beside the quantification of the cell components that were not removed during decellularization, the scaffold can be subjected to measurements of mechanical stability (16, 17). There is no established threshold concentration of residual cellular material present within the scaffold over which could have a negative effect on recellularization and transplantation (3).

Table 1 Decellularization procedures used in different studies

Species Decellularization

agents and concentration Duration of perfusion

References

rat

SDS 1% overnight

13 deionized water -

Triton-X100 -

rat

SDS 1% 12 h

11 deionized water 15 min

Triton-X100 30 min

mice

frozen an -80 °C -

8

deionized water 10 min

phosphate buffered saline 10 min x2

Trypsine 0.02%, EDTA 0.05%, NaN3 0.05% 20 min

SDS 1%, NaN3 0.05% 10 min

Triton-X100 3%, EDTA 0.05%, NaN3 0.05% 10 min

Deoxycholic acid 4% 5-10 min

porcine SDS 4% in phosphate buffer (PBS) 12 h

17 intermittent washing PBS every 3 h 15 min

porcine

Trypsin 0.02%, EDTA 0.05%, NaN3 0.05% 2 h

16 Triton-X100 3%, EDTA 0.05%, NaN3 0.05% 2 h

Deoxycholic acid 4% 2 h

The most frequently used methods used to evaluate the level of

decellularization are histological, immunohistochemical, immunofluorescence, DNA quantification, electron microscopy and the evaluation of biomechanical stability.

Between the histological methods the (Hematoxylin and eozin) H&E staining is frequently used to reveal the presence of cells and cell‟s nucleus (17). To evaluate the presence of nuclear material 4‟,6-diamino-2-phenylindole (DAPI) staining is also used (10, 14, 17). Movat‟s pentachrome staining is used to allow observation of the distribution of nuclei, elastic fibers, collagen, glycosaminoglycans, fibrin and muscle (14, 16). Herovici staining can be used to discriminate and observe collagen I and III in the scaffold (14, 16). Masson‟s trichrome staining can be used to see the effect of surfactants on collagen arrangement in the tissue (10). Immunohistochemistry and immunofluorescence techniques are used to stain specific components of extracellular matrix scaffold like: elastin, fibronectin, laminin, hyaluronic acid and heparin sulfate. To evaluate the scaffold in a much higher detail electron microscopes can be used, both SEM


122

(scanning electron microscopy) and TEM (transmission electron microscopy) (8, 10).

DNA identification and isolation is an effective technique to evaluate the efficiency of decellularization. Quantification of DNA can be done using a spectrophotometer or by PCR techniques where small amounts of DNA can be amplified to generate millions of copies of a specific DNA sequence (18).

The evaluation of biomechanical stability by comparison of native and decellularized heart can be done by introducing a latex balloon catheter into the left ventricle via aorta and connect it to a precision calibrated syringe for administration and withdrawal of fluid, with the help of a micromanometer the pressure can be measured at different left ventricle volumes (16, 17). In regards to the evaluation of mechanical properties of the decellularized heart scaffold, non invasive measurements can be made using multiphoton microscopy and image correlation spectroscopy (9). The study suggests that the collagen content and elastin alignment determine the mechanical properties of the extracellular matrix (9).

Other evaluation criteria for the extracellular matrix are the quantitative analysis of extracellular matrix proteins. Using different kits the fallowing proteins can be quantified: hydroxyproline levels which give indirect values of insoluble collagen, glycosaminoglycans, elastin and soluble collagen (10)

Based on several studies the fallowing minimum criteria are sufficient to satisfy the finalization of the decellularization process (3):

<50 ng dsDNA/ mg scaffold dry weight

<200 bp DNA fragment length

lack of visible nuclear material in tissue sections stained with DAPI or H&E.

Achievements and challenges

In the past few years several studies have been made in regards to whole heart decellularization, but since the final goal is to obtain a functional beating heart by means of recellularization, only two studies can be mentioned. The first study in which they obtained a functional beating heart is the study of Ott et al., from 2008. In this study rat hearts were decellularized by coronary perfusion, preserving the underlying extracellular matrix and obtaining an acellular, perfusable vascular architecture, competent acellular valves and intact chamber geometry. The scaffolds were reseeded with cardiac and endothelial cells. The scaffolds were maintained for up to 28 days in a bioreactor. By day 4, macroscopic contractions were observed. By day 8, the construct could generate pump function, equivalent to about 2% of an adult or 25% of a 16 week fetal heart function (11). The second study in which a beating heart was obtained is the study of Lu et al. from 2013. Experiments were conducted on mice hearts and the decellularized hearts were seeded with human induced pluripotent stem cells-derived multipotential cardiovascular progenitor cells. The multipotential cardiovascular progenitor cells migrate, proliferate and differentiate in situ into


123

cardiomyocytes, smooth muscle cells and endothelial cells to reconstruct the decellularized hearts. After 20 days of perfusion the heart tissue started spontaneous contractions, generated mechanical force and was responsive to drugs. Also, the extracellular matrix promoted cell proliferation, differentiation and myofilament formation (8). A major challenge in this area of whole organ bioengineering is to preserve the integrity and structure of the scaffold at a macroscopic, microscopic and molecular level. For this reason is very important to select the optimum decellularization procedure or combination of methods. Another important challenge is to establish some thresholds in regards to when the decellularization process is finished using non invasive, reliable methods. The next important challenge is related to the source of organs. Using pig organs would greatly simplify the problem because of the advantages they possess.

Acknowledgement

This paper is partly supported by the Sectorial Operational Programme Human Resources Development (SOPHRD), financed by the European Social Fund and the Romanian Government under the contract number POSDRU 141531.

References 1. Aubin, H., Kranz, A., Hulsmann, J., Lichtenberg, A., Akhyari, P.,

Decellularized whole heart for bioartifcial heart, Methods in Molecular Biology 2013, 1036, 163-178.

2. Azhim, A., Syazwani, N., Morimoto, Y., Furukawa, K., Ushida, T., The use of sonication treatment to decellularize aortic tissues for preparation of bioscaffolds, Journal of Biomaterials Applications, 2014, 29, 130-141.

3. Carpo, P.M., Gilbert, T.W., Badylak S.F., An overview of tissue and whole organ decellularization processes, Biomaterials, 2011, 32, 3233-3243.

4. Carvalho, J.L., de Carvalho, P.H., Gomes, D.A., Goes, A.M. Characterization of Decellularized Heart Matrices as Biomaterials for Regular and Whole Organ Tissue Engineering and Initial In-vitro Recellularization with Ips Cells. Journal of Tissue Science and Engineering 2012, S11:002. doi:10.4172/2157-7552.S11-002

5. Galvez-Monton, C., Prat-Vidal, C., Roura, S., Soler-Botija, C., Bayes-Genis, A., Cardiac tissue engineering and the bioartificial heart, Revista Espanola de Cardiologia, 2013, 66(5), 391-399.

6. Guyette, J.P., Gilpin, S.E., Charest, J.M., Tapis, L.F., Ren, X., Ott, H.C., Perfusion decellularization of whole organs, Nature Protocols, 2014, 9(6), 1451-1468.

7. Liu, Q., Wang, H., Tissue regeneration: When nano structure meets biology, Chapter 3 – Decellularization Scaffolds: Concepts, Methodologies, and


124

Applications in Cardiac Tissue Engineering and Whole-Organ Regeneration, Ed. World Scientific Publishing, Singapore, 2014.

8. Lu, T-Y., Lin, B., Kim, J., Sullivan, M., Tobita, K., Salma G., Yang, L., Repopulation of decellularized mouse heart with human induced pluripotent stem cell-derived cardiovascular progenitor cells, Nature Communications, 2013, 4:2307, doi:10.1038/ncomms3307.

9. Merna, N., Robertson C., La, A., George, S.C., Oprical imaging predicts mechanical properties during decellularization of cardiac tissue, Tissue engineering: Part C, 2013, 19(10), 802-809.

10. Methe, K., Backdahl, H., Johansson, B.R., Nayakawde, N., Dellgren, G., Sumitran-Holgersson, S., An alternative approach to decellularize whole porcine heart, BioResearch Open Access, 2014, 3(6), 327-338.

11. Ott, H.C., Matthiesen, T.S., Goh, S.K., Black, L.D., Kren, S.M., Netoff, T.I., Taylor, D.A., Perfusion-decellularized matrix: using nature‟s platform to engineer a bioartificial heart, Nature Medicine – Technical Reports, 2008, 14(2), 213-221.

12. Remlinger, N.T., Wearder, P.D., Gilbert, T.W., Procedure for decellularization of porcine heart by retrograde coronary perfusion, Journal of Visualized Experiments, 2012, 70, 1-8, e50059, doi:10.3791/50059.

13. Robertson, A.J., Dries-Devlin, J.L., Kren, S.M., Burchfield, J.S., Taylor D.A., Optimizing recellularization of whole decellularized heart extracellular matrix, PlosOne, 2014, 9(2): e90406. doi:10.1371/journal.pone.0090406.

14. Wainwright, J.M., Czajka, C.A., Patel, U.B., Freytes, D.O., Tobita, K., Gilbert, T.W., Badylak, S.F., Preparation of cardiac extracellular matrix from an intact porcine heart. Tissue Engineering: Part C, 2010, 16(3):525-536.

15. Wang, B., Tedder, M.E., Perez, C.E., Wang, G., de Jongh Curry, A.L., To, F., Elder, S.H., Williams, L.N., Simionescu, D.T., Liao, J., Structural and biomechanical characterizations of porcine myocardial extracellular matrix, Journal of Material Sciences. Materrials in Medicine, 2012, 23, 1835–1847.

16. Weymann, A., Loganathan, S., Takahashi, H., Schies, C., Claus, B., Hirschberg, K., Soos, P., Korkmaz, S., Schmack, B., Karck, M., Szabo, G., Development and evaluation of perfusion decellularization porcine heart model – generation of 3-dimensional myocardial neoscaffolds, Circulation Journal, 2011, 75, 852-860.

17. Weymann, A., Patil, N.P., Sabashnikov, A., Jungebluth, P., Sevil Korkmaz S., Li S., Veres, G., Soos, P., Ishtok, R., Chaimow, N., Patzold, I., Czerny, N., Schies, C., Schmack, B., Popov, A-F., Simon, A.R., Karck, M., Szabo, G., Bioartificial heart: A human-sized porcine model – the way ahead, PlosOne, 2014, 9(11) e111591. doi:10.1371/journal.pone.0111591.

18. Zia, S., Mozafari, M., Natasha, G., Tan, A., Cui Z., Seifalian A.M., Hearts beating through decellularized scaffolds: whole-organ engineering for cardiac regeneration and transplantation, Critical Reviews in Biotechnology 2015 doi:10.3109/07388551.2015.1007495.


125

THE MORPHOPATHOLOGICAL PREVALENCE OF UNINFLAMMATORY NEPHROPATHIES IN DOGS

A. OLARIU-JURCA, A. STANCU, ILEANA NICHITA, LILIANA ELENA TESLICI, A. LAZĂU, I. OLARIU-JURCA

Banat‟s University of Agricultural Sciences and Veterinary Medicine ”King

Michael I of Romania” from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania


Summary

The morphopathological study of uninflammatory nephropathies in dogs has been conducted using macroscopic and microscopic identification and description of renal lesions as well as establishing their prevalence.

The research has been done in the period of October 2011-November 2014 through anatomopathological examination of eviscerated kidneys from 40 dog corpses, of different age, sex and breed. The dogs came from private owners, kennels and animal shelters and they were necropsied during Forensics classes at the Faculty of Veterinary Medicine in Timisoara.

Out of a total of 40 necropsied cases, 22 cases (55%) presented uninflammatory nephropathies: adaptive nephropathies-2 cases (5%), circulatory nephropathies-5 cases (12.5%) and degenerative- 15 cases (37.5%).

The microscopic exam of the histopathological preparations, obtained from renal samples and processed using the paraffin technique, cut at 6 μm and stained using the HFA method, Congo red method and Perls method, reveal the following nephropathies : renal atrophy caused by cystic compression, passive renal congestion and renal steatosis, granular and vacuolar tubulo-nephrosis, hyaline, amyloid and hemosiderin glomerulo-nephrosis and tubulo-nephrosis. The dystrophic lesions were dominant and they were represented by lipid, protein and pigmentary nephrosis.

Key words: morphopathological, uninflammatory nephropathy, dogs

The kidneys intervene in blood cleansing and in homeostasis ensuring that the blood is isotonic, isohidric isoionic and isovolemic. The final products of the metabolism are eliminated through the kidneys, especially the products of the protein catabolism, toxic products which come from intestinal rotting, resulting in urine having a toxic character. The kidneys are the headquarters of different and numerous pathological processes, with a large diversity of clinical and morphopathological forms (1, 7, 9).

The kidneys, through the multitude of functions they perform in the organism, come in contact with various biotic and abiotic pathogen agents who enter the renal parenchyma on urinary path (ascendant) or haematogenous path (descendant). These pathogen factors cause numerous and diverse renal lesions, translated through development disorders, circulatory disorders, dystrophic


126

processes, inflammatory process and tumors. The renal dominant pathological uninflammatory processes are exteriorized through different morphopathological dystrophic, lipid and protein forms that are variable in extent and intensity (3, 5, 6, 7).

Materials and methods The research of the present study was conducted in the period October

2011-November 2014, by conducting anatomopathological examinations of kidneys which came from 40 dog corpses of different age, sex and breed, owned by private individuals, kennels or animal shelters and they were necropsied during Forensics classes at Veterinary Medicine Faculty Timisoara.

Out of a total of 40 necropsied cases, 22 bodies presented uninflammatory nephropathies. Samples were taken from these cases and were used for a histopathological exam. The samples were fixated using formaldehyde 10% and then they were processed using the paraffin technique, cut at 6 μm an stained using the HEA, Perls and Congo red methods.

The histopathological preparations thus obtained were examined using a research microscope MC 5 A equipped with oculars starting from 10 and the photography was done using an Olympus CX41 microscope (acquired through POS CCE, DICES-MVT 2669-145). After the examination and interpretation of the histopathological preparations, microphotographs were made which illustrate the most characteristic histological modifications.


The research regarding uninflammatory nephropathies in dogs was

systemized into three groups: adaptive, circulatory and degenerative nephropathies (Table 1).

Table 1 Necropsied dogs uninflammatory nephropathies

Crt. no.

Necropsied canines

Nephropathies

Adaptive Circulatory Degenerative

Total AC Total C He I Total Lipid Protein

1 40 2 2 5 3 1 1 15 5 10

Legend

AC= renal compression atrophy C=congestion He=haemorrhages I=infarction


127

The adaptive nephropathies were identified in two cases and were represented by renal peri-cystic compression atrophy, a consequence of urinary retention cysts.

Macroscopically, during inspection we noticed a wavy aspect of the kidneys due to the presence on surface and section of numerous cysts of various formation and sizes. In the area of the cyst, the renal parenchyma was limited to a simple membrane, more or less transparent (partial atrophy), depending on the degree of the cyst‟s extension. The shape of the organ was kept, so was the colour but with a lighter nuance, the consistency was heightened due to a smaller quantity of liquid. On the section surface we noticed the lowering in volume of the two areas of the kidney (cortical and subcortical) and the presence of single or multiple macro and microcysts (highly dilated uriniferous tubes) (Fig. 1).

The circulatory nephropathies are represented by congestions, haemorrhages and infarctions, with a total of 5 cases.

Passive congestion (shock kidney) was signalled in 3 cases. It was exteriorised through volume and weight enlargement, a red-purple colour noticed both on surface as well as on section. Dark blood is noticed on the surface of the section (Fig. 2).

Fig. 1. Urinal retention microcysts- Pericystic compression renal atrophy

Fig. 2. Passive renal congestion (shock kidney: dark red colour at inspection and

on section)

Renal haemorrhages were signalled in one of the cases. They can be signalled in various morbid conditions with sizes ranging from the head of a needle (Herpesvirus) to haematomas extended subcapsulary (trauma), perirenal or inside the renal pelvis (intoxications with oxicumarine).

White renal infarction was identified in one of the dogs and it appeared as a yellow necrosis area, with the shape of a cone or pyramid, with the base at the surface of the organ and the tip towards the hilum. The recent infarctions (acute) showed friable consistency, they were slightly prominent under the capsule; they


128

had yellow colour and a brown border, according to the calibre of the blocked artery.

Generally, the nephropathies evolved together, having a common etiopathogenesis on many occasions.

Degenerative nephropathies were the most numerous lesions, diagnosed in 15 cases out of which 5 cases were lipid dystrophies and 10 cases macroscopically corresponded to protein dystrophies.

Steatonephrosis or lipid renal dystrophy was expressed through a slight enlargement or even normal size in the kidneys, a level or in focuses yellow colour and heightened friability (Fig.3). The quantity and distribution of lipids in the kidney varies according to the species. Normally, minimal quantities of lipids may be noticed in the nephrons of pigs, dogs and cattle during the first 5 days of life.

The renal steatosis evolves at the same time with the hepatic one, under the name of hepato-renal lipid syndrome”. This lesional syndrome was signalled in the consulted specialty literature (3, 5, 6).

Protein dystrophies were diagnosed in 10 cases; the kidneys were faded on the entire surface or only on circumscribed areas, without shine, friable and frequently with an aspect similar to boiled meat.

These microscopic aspects are almost the same for all protein dystrophies regardless of their histological shape (granular, vacuolar, amyloid, hyaline, etc.) (5, 7). The certain diagnosis of degenerative nephropathies is established only through microscopic exam. In most of the situations it is difficult to say if the image caught during examination is a stage in the aggravation of the process or in its healing, especially in the fast evolution of the morphological events. It can be precisely said that degenerative renal lesions are a continuation of circulatory disorders and a previous stage of cellular death, respectively of the inflammatory process. Depending on the location and intensity of the renal lesions, these may cause serious disturbances followed by the death of the organism.

Fig. 3. Lipid - protein nephrosis

Fig. 4. Pericystic compression renal atrophy: a big reduction in volume of the urinary tubules lumen and limitation to a mere hipochrome slit HEA staining, x20


129

The microscopic exam. Out of approximately 22 renal fragment samples, we made 22 histopathological preparations which were stained using the HEA, HE, PERS and Congo red methods.

The diagnosed nephropathies were multiple and complex; they developed simultaneously or successively in different segments or structures, fact which made it possible to make an inventory (Table 2).

Table 2 Histopathological forms of nephropathies

Crt. no.

Nephropathies No. of cases Total

1. Adaptive Pericystic renal compression atrophy 2 2

2.

Circulatory

Congestion ( shock kidney) 3 5

Haemorrhages 1

Infarctions 1

3.

Degenerative

Lipid 5 15

Protein

granular 3

granular-vacuolar 1

hyalin 3

amyloid 2

hemosiderin 1

In the adaptive nephropathies, in the two cases with pericystic renal compression, microscopically, using the objectives: x4, x10 and x20, we noticed: a lowering in the number and volume of the uriniferous tubes and of the renal corpuscle; the epithelium of the tubes was flattened and dystrophic and the lumen was reduced to a barely perceptible hipochrome slit (Fig.5). We also noticed focuses of scar conjunctive tissue which takes the place of renal necrotic tissue and on the edges we could distinguish granular tubulonephrosis and/or granular vacuoles.

In circulatory nephropathies the microscopic exam is necessary in order to make a differential diagnosis between active and passive congestion.

In renal congestion or shock kidney, microscopically we can see an emphasized dilation of the capillaries, interstitial venules and their filling with blood accompanied by the compression of the surrounding cells (Fig. 5).

By comparison to active hiperemia when the red cells are well coloured and individualised, in the passive hiperemia the red cells are glued together, unequally coloured and with high quantities of pigmentation. Renal hypoxia


130

generated by passive hiperemia produces dystrophic modifications of the renal glomerules and of the uriniferous tubes, accompanied by permeability disorders, proteinuria and haematuria and in chronic evolution, accompanied by proliferation of the conjunctive tissue and renal stasis induration. These circulatory changes recorded by us, correspond to those described in the consulted literature (3, 5, 7).

The prolonged persistency of the cause and absence of an efficient collateral circulation causes the alteration of the parenchyma, followed by sclerosis.

The majority of the diagnosed infarctions were of ischemic type (white). The recently diagnosed infarctions had the following morphology:

-central necrosis area, in which the structural elements (tubes, glomerules) are recognisable, retracted, faintly coloured or acidophile, with necrobiotic or lysed nuclei. In the stroma one can find dystrophic products such as fybrinoid and hyaline.

-the middle area is made up of a leukocyte barrier with a resorptive and fagocitary role;

-the external or peripheral area with hyperemia and haemorrhagic infiltration

In old infarctions, the perifocal hyperemia reduces itself to disappearance and the neutrophile granulocytes are replaced by macrophages.

As the necrotic detritus is resorbed, around the infarction area the vasculo-conjunctive tissue proliferates, advances and invades the necrotic mass. Through the maturation and retraction of the conjunctive fibres, a retracted, white scar takes birth, which is resistant to sectioning and sometimes contains limestone precipitates.

Degenerative nephropathies- nephrosis- may be the foreplay or epilogue of the various toxic, circulatory, inflammatory and mechanic lesions. They come after or before medical, infectious, surgical, obstetrical, parasitic and iatrogenic diseases. The last two types especially through chemotherapy abuse produce lesions to the tubular epithelium and the crystaluria it causes leads to oliguria or anuria.

Fatty nephrosis or renal steatosis is one of the most frequent forms of nephrosis. The massive accumulation of triglycerids in the nephrocyte signifies major cellular dysfunctions which may end in cellular necrosis. When we use the paraffin technique, the lipid vacuoles represent the place were fat is stored and not fat itself (Fig.6). They can be highlighted in the epithelium of the proximal contort tubes and they lead to cellular tumefaction and reduce the lumen of the tubes. The necrosis of the affected cells with their braking and separation from the basal membrane are stages that participate to the formation of the fatty cylinders. Clinically, the fatty cylinders can be seen in the urinary sediment.

The ethiopathogenesis of steatosis is complex; the causing factors intervene in the synthesis, usage and abnormal mobilisation of fat. The causes of steatosis are represented by: starvation, protein malnutrition, exaggerated intake of lipids through feeding, obesity, tissue hypoxia, action of certain toxins or toxic


131

compounds, etc. (1, 3, 5). Sometimes the accumulation of tryglicerids in parenchymal cells of different organs including the kidney is caused by the impossibility of the hepatocyte to synthesize the specific protein (apoprotein) necessary for the creation of lipoproteins (the elimination form of the cellular tryglicerids) (7, 9).

Fig. 5. Passive renal congestion (shock kidney); Dilation of the capillaries,

venules and their filling with red cells, glued together, HEA staining, x10

Fig. 6. Renal steatosis- uriniferous tubes with optically empty vacuoles, the storage

place of lipids. HEA staining, x40

The low intake of amynoacids or the deficits in ATP in the hepatocyte are

mechanisms which explain the deposit of lipids in the cells of the renal epithelium (1, 5). In the cases taken into study we haven‟t noticed the presence of fatty cylinders in the lumen of the uriniferous tubes but in the cytoplasm of the renocytes numerous optically empty vacuoles were present, which indicates the storage place of the lipids highlighted using the paraffin method.

The renal protein dystrophies were microscopically noticed in 10 cases being represented by granular nephrosis- 3 cases; granular-vacuolar nephrosis- one case; hyaline nephrosis- 3 cases; amyloid nephrosis- two cases and hemosiderin nephrosis- one case.

The granular and granular-vacuolar nephroses are hipoprotein dystrophies, generally reversible and dependent on the aggression of the pathogen factors and on the resistance of the organism. In granular nephrosis, the cells are much grown in volume and present different cytoplasm modifications, exteriorised throughout a turbid aspect which gives it its name: turbid intumescence, or throughout the appearing of granulations in the cytoplasm, of different shapes and sizes, which blur the nucleus (Fig. 7). Granular nephrosis installs rapidly in the renal cells that are subjected to the aggression of several toxic factors, hypoxia and febrile states. The cells gradually come back to their initial morphology if the pathogenous factors are removed in time. If not, the lesion complicates itself, taking the form of vacuolar dystrophy that evolves towards cellular necrosis (3, 5, 8).


132

The granular-vacuolar nephrosis is an aggravation of the cellular hiperhydration and it may have the same etiology and pathogenesis as the granular dystrophy.

Cellular hyperhydration causes cytoplasm swelling, optically empty vacuoles to appear, vacuoles that are barely delimited, which do not get stained using the indicated methods for the highlighting of glycogen and lipids. The nucleus stays in normal position as long as cellular necrosis isn‟t installed.

Hyaline nephrosis, in three cases, was identified in the cytoplasm of the renocytes, in the shape of oxyphil granulations (intracellular hyaline) and in the lumen of the uriniferous tubes in the shape of homogenous spheres, basophile or acidophile (Fig 8).

Fig 7. Protein nephrosis- granular-vacuolar tubulonephrosis; basophile granulations in the cytoplasm of the

renocytes, HEA staining x40

Fig. 8. Hyalin nephrosis: intracellular and extracellular hyaline (hyaline cylinders)

HEA staining x20

The deposits of intracellular hyaline appear when the glomerule filtration barrier is altered, which is noticed in acute or chronic renal affections. They represent hypertrophies of the lysosomes and it was identified in three cases. By rupturing the apical pole of the nefrocytes with hyaline, in the lumen of the tubes are formed hyaline cylinders which are eliminated through urine (3, 5, 9).

Amyloid nephrosis was identified in two cases, microscopically; in the histopathological preparations stained with Congo red we could highlight the presence of the amyloid in the endothelial cells and in the basal membrane of the glomerular capillaries as well as in the mesangial space, in the shape of amorphous oxyphile deposits (Fig. 9). The walls of the glomerular capillaries are much thickened, leading gradually to the disappearance of the glomerule filtration space and to the setting of chronic renal failure (4, 9).

Hemosiderin nephrosis was signalled in one case, being the consequence of massive erythrolysis, in the case of internal bleeding as well as in haemolytic viral, toxic or parasitic anaemia, in the case of anoxia caused by prolonged stasis


133

of the blood. The kidneys have a brown rusty colour on the surface and on section especially in the cortical area. Microscopically, when Perls staining method is used, the presence of blue spheres is highlighted, in the epithelium of the renal tubes, in the lumen of the uriniferous tubes and in the macrophages (Fig. 10).

Fig. 9. Amyloid nephrosis: amyloid tubular

and granular nefrosis. Congo red staining x4

Fig. 10. Hemosiderin nephrosis: intraepithelial hemosiderosis and

hemosiderin cylinders Perls staining x20.

Conclusions

Necropsy examination of 40 corpses of dogs, different breeds, ages and sexes, completed with histological examination of the kidneys from 22 cases with uninflamatory nephropathies, suggests the following conclusions on renal pathology in dogs.

Kidney lesions of varying degrees in 55% of cases examined, showing a very high involvement in renal pathology of this species.

Renal lesions diagnosed cases studied were many and complex, externalized by atrophy due to compression (5%), circulatory disorders (12.5%) and dystrophies (37.5%).

Dystrophic lesions are dominant, being represented by lipid nephrosis and protein nephrosis.

References

1. Angus, K.W., Nephropathy in young animals, Jowa State Universizy Press, Ames, 1990.

2. Brown, C. A., Crowell, W.A., Brown, S.A., Barsanti, J.A., Finco, D.R., Suspected Familial Renal Disease in Chow Chows. J Am Vet Med Assoc 196 (8), 1279-1284, 1990.

3. Confer, A., Panciera, R., The urinary system. In: special veterinary pathology, Edit. by. Gavin,M.D., Carlton W.W., Zachary, F.J.,Mosby,


134

S.U.A., edition 3, 235 -271, 2001. 4. Dibartola, S.P., Tarr, M. J., Parker, A., Powers, J.D., Pultz, J.A.,

Chimicopathologic findings in dogs with renal amyloidosis 59 cases (1976-1986) J. Am. Vet. Med. Assoc, 195, 358-364, 1989.

5. Maxie, M.G., The urinary System. In Pathology of Domestic Animals, Edit. By Jubb K.V.F., Kennedy P.C., Palmer N., San Diego Academic Press, New York, II, 4th ed., 447-538, 1993.

6. Pasca, S.A., Paul, I., Aspecte morfopatologice in nefropatiile distrofice la caine. Lucr. Stiint USAV Iasi, vol 50, Ed Ion Ionescu de la Brad, Iasi, 2007.

7. Paul, I., Morfopatologia aparatelor şi sistemelor organice. Bul Inf. al SMV, 1990, nr. 23-24, Bucureşti.

8. Richman, A.V., Gerber, L.I., Balis, J.U., Peritubular capillaries. A major target site of endotoxin-induced vascular injury in the kidney, Lab.Invest., 1980, 43, 327-332.

9. Solcan , GH., Bolile rinichilor. În Medicina internă a animalelor, coordonator C. Falcă, Ed. Eurostampa, Timişoara, vol II, 46-72, 2011.

10. Sultton, R.H., Atwell, R. B., Renal haemosiderosis in association with canine heartworm disease. J. Small Anim Pract, 1992, 23, 733-777.


135

MORPHOPATHOLOGICAL QUANTIFICATION OF INFLAMMATORY NEPHROPATHIES AND TUMOURS IN DOGS

I. OLARIU-JURCA

1, ILEANA NICHITA

1, A.STANCU

1, V. CIULAN

1, E. AVRAM

2,

A.OLARIU-JURCA1

1 Banat‟s University of Agricultural Sciences and Veterinary Medicine ”King Michael

I of Romania” from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania

2Vasile Goldis Western University Arad, Romania


Summary

The research of the present study was conducted through observation, description and microscopic and macroscopic interpretation of renal inflammatory and tumor lesions and based on their prevalence in dogs.

The study was conducted in the period October 2011-November 2014 by anatomopathological examinations of kidneys eviscerated from 40 dog corpses, of different ages, sex and breed, coming from private owners, kennels or animal protection services in the Timis and Arad County. The bodies were necropsied In the Forensics section of the Veterinary Medicine Faculty in Timisoara.

From these cases, seven dogs were diagnosed macroscopically and microscopically with inflammatory nephropathies and one case was diagnosed with renal adenoma. The histopathological exam of the preparations obtained using the paraffin technique and stained using the HEA method showed the following: inflammatory nephropathies represented by membranous glomerular nephritis, 2 cases (5%); fibrous glomerular nephritis, one case (2,5%); purulent interstitial nephritis, one case (2,5%); interstitial limphohistiocytic nephritis, 2 cases (5%); fibrous interstitial nephritis one case (2,5%) and as tumors we discovered one case with renal adenoma (2,5%). The noticed renal lesions developed simultaneously or successively in several segments or renal tissular structures.

Key words: morphopathological, inflammatory, tumor, dogs

The inflammatory and tumor nephritis is caused by different pathogens,

biotic or abiotic which approach the kidney by ascendant or descendant paths (2, 4, 7).

The ethiology of nephropathies is complex and is represented by metabolic factors, toxic factors, septic diseases, bacterial or viral, and sometimes fungi or parasites (3, 6, 8).

Due to the action of various pathogens, inflammatory processes are installed. They are predominantly glomerular-glomerular nephritis; predominantly tubular- tubular nephritis and predominantly interstitial- interstitial nephritis (1, 4, 5, 9).


136

The renal tumor processes mostly affect the epithelium of the uriniferous tubes and of the renal glomerules (adenomas and carcinomas) but they may also affect the renal interstice (fibroma, sarcoma) (2, 7, 9).


The research of the present study was conducted in the period October 2011-November 2014, by conducting anatomopathological examinations of kidneys which came from 40 dog corpses of different age, sex and breed, owned by private individuals, kennels or animal shelters and they were necropsied during Forensics classes at Veterinary Medicine Faculty Timisoara.

Out of a total of 40 necropsied cases, 7 bodies presented inflammatory nephropathies. Samples were taken from these cases and were used for a histopathological exam. The samples were fixated using formaldehyde 10% and then they were processed using the paraffin technique, cut at 6 μm and stained using the HEA method.

The histopathological preparations thus obtained were examined using a research microscope MC 5 A equipped with oculars starting from 10 and the photography was done using an Olympus CX41 microscope (acquired through POS CCE, DICES-MVT 2669-145). After the examination and interpretation of the histopathological preparations, microphotographs were made which illustrate the most characteristic histological modifications.


Inflammatory and tumoral nephropathies were diagnosed in eight out of 40 cases: glomerule nephritis- three cases, suppurative interstitial nephritis- one case, interstitial lymphohistiocitary nephritis- two cases and fibrous nephritis- one case, tumors (adenoma) – one case (Table 1, fig. 1).

Table 1

Nephropathy at necropsied dogs

No Nephropathies No. of cases

Total

1.

Inflammatory

Glomerule nephritis

membranous fibrous (sclerosing)

2 1

7 Interstitial nephritis

(I.N.) I.N. suppurative I.N. lymphohistiocitary I.N. fibrous

1 2 1

2.

Tumors

Benig Malign

1 -

1


137

Fig. 1. Quantification of inflammatory nephropathies and tumors

Macroscopically. Suppurative nephritis is morphopathologically enhanced

by purulent circumcised inflammations (abscess) and by diffuse purulent inflammations- one case. The purulent shapes have evolved in most cases under circumcised shape (abscess), and we could notice white nodes on the surface of the kidneys or scattered subcapsularly in the cortical and less in the medulla (Fig. 2.). The content of the nodes was purulent and their outlines suffered from hyperemia. After the evacuation of the puss, we could highlight the capsule of the abscess which showed on its internal face, of white-pink color, a fiber-purulent deposit, adherent to the capsule.

They were caused by metastasis from the pre-existent purulent focuses: in the mammary gland, feet and navel.

Interstitial lymphohistiocitary nephritis was the most frequent renal inflammation in dogs, developing mostly in focuses and the acute stages were caused by toxic substances, more precisely infectious agents (leptospirosis).

The fibrous interstitial nephritis is a prolonging of the chronic shapes of lymphohistiocitary nephritis respectively a chronic stage of all the alterative and exudative forms of nephritis.

The tumoral nephropathies were identified in one case and were represented by the renal adenoma. The renal adenoma is a benign epithelial tumor, an expression of moderate or accelerated multiplication of the epithelium of the renal glomerules and of the uriniferous tubes. The kidneys were enlarged, of white-grey color, high consistency and fatty aspect on section.


138

Microscopically. The inflammation of the renal parenchyma was reported in seven cases, affecting the renal glomerules, the uriniferous tubes and the renal interstitial space.

Glomerulenephritis was reported in three cases; membranous glomerulitis in two cases and sclerosis glomerulenephritis in one case. The membranous glomerulitis is an immune based inflammation, caused by the accumulation of circulatory immune deposits on the glomerular basal membranes. Microscopically the glomerular basal membrane is thickened in the area of the glomerular capillaries with slightly enlarged lumens. Proliferation of the mezangial cells and the growth of their matrix is evident. We have also noticed the presence of granular and lipid distrophies accompanied by plasmoexodie of the seric proteins, proteinuria and nephritic syndrome. According to BOWEE, the membranous glomerulenephritis represents the morphological support for the nephritic syndrome (7).

The membranous glomerulenephritis may be a consequence of chronic septic diseases (pyometra in bitches), metabolic diseases (diabetes and thyroiditis), of autoimmune idiopathic diseases (unidentified immune complexes) and last but not least old age (2,5,7).

Sclerosis glomerulitis reported in one case is microscopically enhanced by fibroconjunctival hyperplasia which causes atrophy by compression of the vascular ball followed by necrosis and in time by its replacement with conjunctive tissue (Fig. 3).

The interstitial nephritis was reported in 4 cases: purulent interstitial nephritis in one case, lymphohistiocitary interstitial nephritis in two cases and fibrous interstitial nephritis in one case.

The purulent interstitial nephritis, reported in one case, was diagnosed histopathologically through the presence of circumcised or diffuse leukocytary exudate, present around the uriniferous tubes which are compressed and necrotic and in the renal corpuscles we may notice a purulent glomerulitis. Peripherally we notice blood vessel dilation and intertubular haemorrhages. In the uriniferous tubes we notice the presence of granulocytes and neutrophils and desquamated epithelial cells (leuckocyte cylinders) (Fig. 4).

In the structure of the abcess wall, microscopically using the 10, 20, 40 objectives we could observe, from outside to inside-3 areas: internal area- with the role to reabsorb, in contact with the puss, made of macrophages and neutrophils; the median area- reparatory or hyperplasic, made of cells, fresh conjunctive fibres and neoformation vessels (granulation tissue), oriented circularly and of blue colour and the external area of defense represented by a capsule made of adult conjunctive tissue which delimits the inflammatory focus from the renal tissue in which it has developed.

Lymphohistiocitary interstitial nephritis was microscopically identified in two cases, being the most frequent renal inflammation. They developed mostly in focuses and in most of the cases they were caused by infectious agents-


139

leptospirosis. However, it may also be noticed in intoxications allergies or viral diseases. It has an acute, subacute or chronic evolution and it appears in focuses or diffused. The nodular or circumcised pattern: we could notice on the background of red-brown, enlarged kidneys, white focuses of various dimensions, unique or multiple prominent on the surface of the kidney. On the section surface the white focuses had a fatty aspect and had the shape of bands of the same color as the exterior layer, with parallel margins covering the entire cortical area and part of the medullar area. The kidneys suffering from the diffused form were enlarged, fatty, of grey-white colour and on section there could be noticed parallel bands faintly delimited by the rest of the parenchyma. The histological images show the diffuse lymphohistiocitary proliferation or the periglomerule, peritubular or perivascular proliferation in focuses, with compressive atrophy of the nephrons (Fig. 5.).

The etiology of the cases of lymphohistiocitary nephritis was probably of leptospiric nature but also of food-poisoning nature.

The interstitial fibrous nephritis was signaled in one case, being the result of chronic nephritis. Interstitial fibrilogenesis and the fibrous transformation of fibriles intervene in its morphogenesis and it is due to them that the cellular structures are replaced by fibrous scars and we notice the sclerosis kidney (Fig. 6.). Macroscopically the kidneys were shrunk in volume, white, with an irregular surface and a cerebral aspect. The consistency was high and a squeaky noise could be heard while cutting. The cortical was unequal, reduced in volume and with white streaks which continue into the medulla.

Renal tumors. The cases taken into study presented only with one case of renal adenoma. Moderate tumoral hyperplasia of the epithelium of the uriniferous tubes (simple adenoma) and heightened hyperplasia of the uriniferous tubes are present (papilliferous adenoma) (Fig. 7).

Fig. 2. Renal abscess

Fig. 3.Sclerosis fibrous glomerule nephritis: concentric periglomerule fibro-conjunctive hyperplasia. Stain HEA x40


140

Fig. 4. Purulent interstitial nephritis: periglomerule and peritubular exudate interstitial leucocyte. Stain HEA x20

Fig. 5. Lymphohistiocytic interstitial nephritis: peritubular, periglomerular and

mesangial lymphocytic and histiocytic hyperplasia. Stain HEA x40

Fig. 6. Interstitial fibrous nephritis, small

wrinkled kidney: interstitial fibro-conjunctive hiperplasia. Stain HEA x20

Fig. 7. Renal adenoma: simple adenoma and papilliferous adenoma of the urinary

tubes epithelium. Stain HEA x 40

The macroscopical and microscopical aspects of the inflammatory and tumor nephropathies noticed and described by us also appear in the specialty literature we consulted but their prevalence was not mentioned (2,4,7).

Conclusions

Inflammatory neuropathies, anatomopathological diagnosed at the cases

studied, were developed simultaneously or successively in several segments and structures, being externalized by glomerulonephritis and interstitial nephritis.

The identified glomerulonephritis are represented by the membranous glomerulonephritis (5%) and fibrous glomerulonephritis (2.5%).


141

Acute, subacute and chronic interstitial nephritis are almost constant at older dogs, manifested anatomopathologicaly through purulent nephritis (2.5%), limphohistiocitary nephritis (5%) and fibrous nephritis (2.5%).

Renal tumor processes have a relatively low incidence being represented by adenomas (2.5%).

References

1. Bovee, K.C., Canine nephrology – Diseases of the tubules and

interstitium, Harwal Pub. Co, 1984. 2. Confer, A., Panciera, R., The urinary system. In: special veterinary

pathology, (eds) Gavin, M.D., Carlton W.W., Zachary, F.J.,Mosby, S.U.A., edition 3, cap 5: 235 -271, 2001.

3. Jergens, A.E., Glomerulonephritis in Dogs and Cats‟‟, Compendium Small Animal, 1987, Vol.9, No.9.

4. Maxie, M.G., The urinary System. In Pathology of Domestic Animals, Edit. By Jubb K.V.F., Kennedy P.C., Palmer N. Academic Press, New York, II, 343-411, 1985.

5. Moreau, G., Glomerulo-nephrites lesions observes, Pratique medicale et chirurgicale de l‟animal de compagnie. Numero special. Nephrologie, 1985.

6. Osborne, C.A., Finco, D.R., Canine and Feline Nephrology and Urology, Ed. Williams and Wilkins, Baltimore, 1995.

7. Paul, I., (1990) - Morfopatologia aparatelor şi sistemelor organice. Bul Inf. al SMV nr. 23-24, Bucureşti, 1990.

8. Solcan, GH., Bolile rinichilor. În Medicină internă a animalelor, coordonator C. Falcă, Ed. Eurostampa, Timişoara, vol II, 46-72, 2011.

9. Trautwein, G., Hewicker- Trautwein, M., Mechanisms of Glomerulonephritis in Domestic Animals‟‟, European Journal of Veterinary Pathology, 2000, 6, 3.


142

CHONDROGENIC DIFFERENTIATION OF PERIODONTAL GRANULATION TISSUE DERIVED STEM CELLS

EMOKE PALL

1,2, OLGA SORITAU

3, ALEXANDRA ROMAN

2

1University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca,

Romania, 3-5, Manastur street, 400372 Cluj-Napoca, Romania 2Iuliu Hatieganu University of Medicine and Pharmacy, Cluj-Napoca, Romania, 15

Victor Babes¸ St., 400012 Cluj-Napoca, Romania, 3Ion Chiricuta Oncology Institute, Cluj-Napoca, Romania


Summary

Recent studies have shown successful isolation of mesenchymal stem cells

(MSCs) from oral cavity such as dental pulp, exfoliated deciduous teeth, periodontal ligament, dental follicle, apical papilla etc. Adult MSCs were also isolated from inflamatory tissue. The aim of this study was to harvest MSCs from periodontal granulation tissue in order to further characterize their chondrogenic potential using specific differentiation medium or co-culture system. The granulation tissue was collected from a patient with chronic periodontitis treated with a pocket reduction surgical approach. After morphological, functional and immunophenotypic characterization the cultures were treated with chondrogenic differentiation medium and co-cultured with mouse chondrocytes. The differentiation potential of granulation tissue derived MSCs was evaluated after 24 days. Our study revealed that the selected biomaterials are biocompatible and can be used as scaffolds for mesenchymal stem cells delivery especially for periodontal regeneration. MSCs isolated from inflamed tissue demonstrate their proliferative capacity and chondrogenic differentiation in both systems and may represent a good source of MSCs for regenerative therapy.

Key words: stem cells, chondrogenic differentiation, granulation tissue

Stem cells are characterized by self renew and capacity to differentiate into mesodermal, endodermal and ectodermal lineages (6, 21, 22). Mesenchymal stem cells (MSCs), possess a great therapeutical potential for tissue engineering (20) and can be collected noninvasively with low morbidity (4,7).

First time isolated in the bone marrow, recently several types of adult stem cells (15) have been isolated from adipose tissue (10), placenta (17), umbilical cord blood (8, 11), dental pulp (15), exfoliated deciduous teeth (12), periodontal ligament (14), apical papilla (18), tooth germs (13), palatal tissue (2,16), etc. Adult MSCs can be also isolated from inflamed tissue (1, 14), which is often considered medical waste and discarded. For this reason the aim of this study was to harvest MSCs from periodontal granulation tissue, in order to further characterization their chondrogenic potential using specific differentiation medium or coculture system.


143

Material and methods

The granulation tissue was obtained from a patient with chronic periodontitis, treated with a pocket reduction surgical approach. The patient provided informed consent, and all the procedure was carried out under approves guidelines of the Institutional Ethics Board of University of Medicine and Pharmacy Iuliu Hatieganu, Cluj-Napoca. The sample was placed in sterile phosphatase saline supplemented with 1% antibiotic antimicotic (Gibco) and transferred to the laboratory. For the MSCs isolation, the granulation tissue was minced and was digested using 3 mg/mL collagenase type I (Sigma) in αMEM culture medium (Sigma). The single cells suspensions were cultured in DMEM/F12 (Gibco) culture medium supplemented with 10% fetal calf serum (FCS, Sigma), 5% horse serum (Gibco) and 1% antibiotic-antimicotic (Gibco). The cultures were maintained at 37°C with 5% CO2 in humidified atmosphere. The cell surface phenotypes were characterized at the 6

th passage using fluorescence-activated cell sorting. All flow

cytometry measurements were made using a FACS Canto II, flow cytometry system (BD Biosciences, San Jose, CA, USA) and analysed using the DIVA program. After morphological, functional and immunophenotypic characterization the cells were aggregated using hanging drops method. After 48h the aggregates were divided into two groups. A part of aggregates were treated with chondrogenic induction medium: DMEM/F-12 (Sigma Aldrich) supplemented with 1% ITS (Sigma Aldrich), 50 nM L ascorbic acid 2-phosphate (Sigma Aldrich), 100nM dexamethasone, 10 ng/ml of transforming growth factor (TGF-b; Sigma Aldrich) and 1% antibiotic/antimycotic (Gibco, Invitrogen). The aggregates from the second groups were cocultured with mouse chondrocytes isolated from the tibial plateaus and femoral condyles. After 14 and 21 days of induction the cells were stained with Alcian Blue solution (Sigma Aldrich) (pH = 2.5) to identify proteoglycans. In order to observe the differences between two groups unpaired t-testing were used. A value of p < 0.05 was considered statistically significant. All data were expressed as the mean ± SD.


MSCs from granulation tissue were isolated using enzymatic dissociation. After first passages (25 days of cultures) the cells were showed a pronounced heterogeneity, triangular and spindle-shaped morphology were predominant. After 6 passages the cells were showed homogeneous morphology (fig.1). The viability and cell numbers were measured, and in vitro self-renewal capacity was controlled based on the CFU-F assay.


144

Fig. 1. Mesenchymal stem cells isolated from granulation tissue and directed differentiation of cells

In order to detect the expression of specific markers we performed a flow

cytometric analysis. Our results shows that the population was CD73+, CD44

+,

CD34- and CD45

- which indicated characteristics of MSCs.The differentiation

potential of granulation tissue derived stem cells was evaluated by culturing the cells in chondrogenic induction medium and in co culture system. After 14 days of differentiation the cells in both culture systems changed their morphology from spindle-shaped to stellate, irregular and cuboidal morphology. After 21 of days of differentiation in coculture system the presence of the dense nodules were observed. The chondrogenic potential as indicated by the presence of proteoglycans only in co culture system (fig.2).


145

Fig. 2. A, B– Granulation tissue stem cells differentiation in coculture system -

Alcian Blue staining

Previous studies suggested the presence of multipotent stem cells in inflamed tissue such as inflamed periodontal ligament (3, 14), inflamed human dental pulp (1), periapical cysts (13). These cells are positive for MSCs markers (14) with highly osteogenic potential and capable of forming mineralized tissue in vivo (13) and highly expressed a set of osteogenic markers, including alkaline phosphatase, Runx2, osteocalcin (14). MSCs have been studied broadly over the past 3 decades (5). Several research groups worldwide have successfully isolated MSCs from a variety of sources, most commonly, healthy tissues and especially bone marrow (19, 23).

In our study granulation periodontal tissue were digested with collagenase for cells isolation. After morphological and functional characterization the cells were grown for 6 passages. After subculturing the presence of MSCs like cells were assumed by their adherence capacity to the plastic surface and their fibroblastic-like morphology. Our data indicated that the granulation tissue derived stem cells express the MSCs specific markers, and the ability of cells to differentiate in chondrogenic lineage.

Conclusions

In conclusion our results show that the inflamed tissue contains multipotent MSCs. MSCs isolated from inflamed tissue demonstrate their proliferative capacity and chondrogenic differentiation in both system and can represent easily accessible sources for regenerative therapy.

Acknowledgements

This paper was published under the frame of European Social Fund, Human Resources Development Operational Programme 2007-2013, project no. POSDRU/159/1.5/S/138776.


146

References

1. Alongi, D.J., Yamaza T., Song, Y., Fouad, A.F., Romberg, E.E., Shi, S, Tuan RS, Huang Gt., Stem/progenitor cells from inflamed human dental pulp retain tissue regeneration potential, Regen Med 2010, 5,617–31.

2. Caballero, M., Reed, C.R., Madan, G., van Aalst, J.A.,Osteoinduction in umbilical cord- and palate periosteum-derived mesenchymal stem cells, Ann Plast Surg. 2010, 64(5), 605-9.

3. Chen, S. C., Marino, V., Gronthos, S. & Bartold, P. M. Location of putative stem cells in human periodontal ligament, Journal of Periodontal Research, 2006, 41, 547–553.

4. d’Aquino, R., Graziano, A., Sampaolesi, M., et al. Human postnatal pulp cells co-differentiate into osteoblast and endotheliocytes, a pivotal synergy leading to adult bone tissue formation, Cell Death Differ, 2007, 14, 1162–1171.

5. De Bari, C., Dell’Accio, F., Tylzanowski, P., Luyten, F.P., Multipotent mesenchymal stem cells from adult human synovial membrane. Arthritis Rheum, 2001, 44, 1928-1942.

6. Gronthos, S., Brahim, J., Li, W., Fisher, L.W., Cherman, N., Boyde, A., DenBesten, P, Gehron, P.R., Shi, S., Stem Cell Properties of Human Dental Pulp Stem Cells, J Dent Res 81(8), 531-535, 2002

7. Khorsand, A., Baghaban, E.M., Arabsolghar, M., Paknejad, M., Ghaedi, B., Rokn, R.A., Moslemi, N., Nazarian, H., Jahangir, S., Autologous Dental Pulp Stem Cells in Regeneration of Defect Created in Canine Periodontal Tissue, Journal of Oral Implantology, 2013, 34,433-443.

8. Lee, K.O., Tom, K. Kuo, Wei-Ming, Chen, Kuan-Der, Lee, Shie-Liang, Hsieh, Chen, T-H., Isolation of multipotent mesenchymal stem cells from umbilical cord blood, Blood, 2004, 103, Number 5

9. Liao, J., Al Shahrani, M., Al-Habib, M., Tanaka, T., Huang, G.T., Cells isolated from inflamed periapical tissue express mesenchymal stem cell markers and are highly osteogenic, J Endod. 2011; 37, 1217-24.

10. Ma, J., Both, S.K., Ji, W., Yang, F., Prins, H-J., Helder, M.N., Pan, J., Cu,i F-Z., Jansen, J.A., van den Beucken, J.J.P., Adipose tissue-derived mesenchymal stem cells as monocultures or cocultures with human umbilical vein endothelial cells, Performance in vitro and in rat cranial defects, J Biomed Mater Res Part A 2014, 102A, 1026–1036.

11. Mennan, C., Wight, K., Bhattacharjee, A., Balain, B., Richardson, J., Roberts S., Isolation and Characterisation of Mesenchymal Stem Cells from Different Regions of the Human Umbilical Cord BioMed Research International Volume 2013, Article ID 916136, 8 pages http, //dx.doi.org/10.1155/2013/916136.


147

12. Miura, M., Gronthos, S., Zhao, M. et al., SHED, stem cells from human exfoliated deciduous teeth, Proceedings of the National Academy of Sciences of the United States of America 2003, 100, 5807–12.

13. Morsczeck, C., Götz, W., Schierholz, J., Zeilhofer, F., Kühn, U., Möhl, C., Sippel, C., Hoffmann, K.H., Isolation of precursor cells (PCs) from human dental follicle of wisdom teeth, Matrix Biol. 2005, 24(2), 155-65.

14. Park, J-C., Kim, J-M., Jung, I-H., Kim, J.C., Choi, S-H., Cho, K-S., Kim, C-S., Isolation and characterization of human periodontal ligament (PDL) stem cells (PDLSCs) from the inflamed PDL tissue, in vitro and in vivo evaluations, J Clin Periodontol 2011, 38, 721–731.

15. Rodriguez-Lozano, F.J., Bueno, C., Insausti, C.L., Meseguer, L., Ramirez, M.C., Blanquer, M., Marin, N., Martinez, S., Moraleda, J.M., Mesenchymal stem cells derived from dental tissues. International Endodontic Journal, 2011, 44, 800–806.

16. Roman, A., Soancă, A., Florea, A., Páll E., In vitro characterization of multipotent mesenchymal stromal cells isolated from palatal subepithelial tissue grafts, Microsc Microanal 2013, 19, 370-80.

17. Shafiee, A., Fisk, N.M., Hutmacher, D.W., Khosrotehrani, K., Patel, J., Fetal endothelial mesenchymal progenitors from the human term placenta, potency and clinical potential, Stem Cells Transl Med. 2015, 13 PII SCTM 2014-0224.

18. Sonoyama, W., Liu, Y., Yamaza, T., Tuan, R.S., Wang, S., Shi. S, Huang, G.T., Characterization of the apical papilla and its residing stem cells from human immature permanent teeth, a pilot study, J Endod. 2008 34(2), 166-71.

19. Sottile, V., Halleux, C., Bassilana, F., Keller, H., Seuwen, K., Stem cell characteristics of human trabecular bone-derived cells, Bone, 2002,30, 699-704.

20. Telles, P.D., Aparecida De Andrade Moreira Machado M, Vivien Thiemy SV, Eduardo NJ., Pulp tissue from primary teeth, new source of stem cells, J Appl Oral Sci, 2011, 19(3), 189-194.

21. Ullah, I., Subbarao, B.R., Rho G-J., Human Mesenchymal Stem Cells - Current trends and future prospective, Bioscience Reports, 2015, doi, 10.1042/BSR20150025.

22. Wei, X., Yang, X., Han, Z.P., Qu, F.F., Shao, L, Shi, Y.F., 2013, Mesenchyma stem cells, a new trend for cell therapy, Acta Pharmacol Sin., 34, 747-754.

23. Zuk, P.A., Zhu, M., Ashjian. P, et al. Human adipose tissue is a source of multipotent stem cells, Mol Biol Cell, 2002, 13, 4279-4295.


148

COMPARATIVE FUNCTIONAL ASSESSEMENT OF PALATAL AND UMBILICAL CORD BLOOD MESENCHYMAL STEM CELLS

EMOKE PALL

1,2, M. CENARIU

1, MIHAELA ADI LUPU

1, ALEXANDRA ROMAN

2,

I.S. GROZA1

1University of Agricultural Sciences and Veterinary Medicine, Cluj-Napoca,

Romania, 3-5, Manastur street, 400372 Cluj-Napoca, Romania, 2 Iuliu Hatieganu University of Medicine and Pharmacy, Cluj-Napoca, Romania, 15

Victor Babes¸ St., 400012 Cluj-Napoca, Romania E-mail: [email protected]

Summary

Mesenchymal stem cells are (MSCs) considered a good sources for regenerative

therapy, because possess self-renewal and multilineage differentiation potentials. MSCs were identified and isolated from bone marrow, placenta tissue, amniotic fluid, umbilical cord blood, adipose tissue, dental pulp, periodontal ligament, exfoliated deciduous teeth, dental follicle etc. The aim of this study was to compare MSCs from palatal tissue and umbilical cord blood in terms of morphology, proliferation and migration capacity as well as trilineage differentiation capacity. Umbilical cord blood MSCs shown higher proliferation capacity but no phenotypic and morphological differences were observed. The number of colony forming unit-fibroblast for umbilical cord blood derived MSCs was significantly higher than that of palatal tissue derived cells. A higher population doubling time and reduced migration potential were recorded in palatal tissue derived cells, but both cell lines demonstred trilineage potential after 21-28 days of induction.

Key words: mesenchymal stem cells, differentiation, CFU-F, regenerative therapy

Mesenchymal stem cells (MSCs) are self-renewing (13, 23) progenitor cells

with multilineage potential, are considered a good sources for regenerative therapy (8), because are easily accessible and can expand to clinical scales in a relatively short period of time (3,18), can be cryopreserved maintaining their characteristics and potency (16). Extensive proliferative ability, capacity to differentiate in vitro into various mesenchymal lineages under appropriate stimulus also is maintained after preservation (2, 14).

MSCs have been isolated from many tissues, including umbilical cord (7, 11, 24), adipose tissue (5,9), and hair follicle (7,15). Also oral cavity represents a novel source of mesenchymal stem cells; these cells can be isolated from dental and orofacial tissue (6, 12 and 20).

The aim of this study was to compare MSCs from palatal tissue and umbilical cord blood in terms of morphology, proliferation and migration capacity as well as the trilineage differentiation capacity.


149


The palatal tissue was obtained from a healthy patient during muco-gingival surgical intervention. The patient received informed consent and all the procedure was carried out under approves guidelines of the Institutional Ethics Board of University of Medicine and Pharmacy Iuliu Hatieganu, Cluj-Napoca. After collection the sample was placed in sterile culture medium supplemented with 1% antibiotics and transferred to the laboratory. The MSCs cells isolation was carried out using enzymatic digestion. The cells were cultured in DMEM/F12 (Gibco) culture medium supplemented with 10% fetal calf serum (FCS, Sigma), 5% horse serum (Gibco) 100 U/ml penicillin (Sigma) and 0.1 mg/ml streptomycin (Sigma) and were maintained at 37°C in a fully humidified atmosphere with 5% CO2. The umbilical cord blood samples were obtained after signed informed consent form healthy women. The sample was collected in tubes with EDTA, and was diluted 1:1 with sterile saline. Mononuclear cells were separated using Histopaque 1077 (Sigma). After centrifugation the cells were suspended in normal propagation medium DMEM/F12 (Gibco) supplemented with 10% fetal calf serum (FCS, Sigma), 5% horse serum (Gibco) 100 U/ml penicillin (Sigma) and 0.1 mg/ml streptomycin (Sigma).

The cells from both sources were characterized at the 6th passage in term

of their morphology, migration potential and differentiation capacity. For testing the clonogenicity of isolated cells, 50 cells/cm2 were seeded in 60-mm diameter Petri dishes. The cultures were fixed after 14 days of cultivation and were stained with Cristal violet (Sigma) and the colonies (> 50 cells) were counted. The cloning efficiency percentage was calculated using the formula cloning efficiency (%) = (number of colonies/number of cells seeded) x100. The migration potential of palatal and umbilical cord blood derived stem cells was determined after passages 6. 3 x10

2 cells were aggregated using hanging drops method. After 48 hours, the

aggregates were harvested and plated into 6-well plates coated with 0.1% gelatin (Sigma-Aldrich, St.Louise, MO, USA). After 24 and 48 h, the migration area was determined following the measurement of aggregates size and the area covered by MSCs after migration. The results were calculated using following formula: Migration area = MSC migration area – Aggregate size.

For evaluating the differentiation potential the cells were cultured to confluence and treated with osteogenic medium: α-MEM supplemented with 10% FBS, 0.1 mmol/l dexamethason, 10 mmol/l βglycerol phosphate, 50 mmol/l ascorbate and adipogenic medium: α- MEM supplemented with 10% FBS, 1 mmol/l dexamethasone, 5 mg/ml insulin, 0.5 mmol/l isobutylmethylxanthine and 60 mmol/l indomethacin for 21 days. For chondrogenesis the cells were aggregated in hanging drops and after 72h were cultured in chondrogenic induction medium DMEM/F-12 (Sigma) supplemented with 1% ITS (Sigma), 50 nM L ascorbic acid 2-phosphate (Sigma), 100nM dexamethasone, 10 ng/ml of transforming growth factor (TGF-b; Sigma) and 1% antibiotic/antimycotic (Gibco). To confirm chondrogenic


150

differentiation, the proteoglycans were identified with Alcian Blue solution (Sigma). The mineralization was assessed by Alizarin red staining and the lipid droplets were confirmed by Oil Red staining. In order to observe the differences between two cells lines unpaired t-testing were used. A value of p < 0.05 was considered statistically significant. All data were expressed as the mean ± SD.

Results and discussion

MSCs from palatal tissue were isolated using enzymatic dissociation. After first passages (10 days of cultures) the cells were showed fibroblastic spindle-shaped morphology. The colonies of cells from umbilical cord blood were observed after 5 days of culturing.

Fig. 1 – A – umbilical cord derived stem cells; B- palatal tissue derived stem cells

The passages were carried out when the cells reached 80 - 90%

confluence. The in vitro self-renewal capacity was controlled based on the CFU-F assay. After 14 days of the experiment, the frequency of colony-forming cells derived from cord blood (72.33±2.51 colonies/60-mm) was significantly higher (P ≤ 0.05) in comparison to the corresponding value for palatal tissue derived cells (56.33±1.52/60-mm) (fig. 2).


151

CF

U-

F

UC

B M

SC

s

PT

MS

Cs

0

2 0

4 0

6 0

8 0

Fig. 2. CFU-F assay

The migration potential of cord blood derived stem cells was higher (0.441

mm2±0.010) compared with cells derived from palatal tissue (0.285 mm

2±0.04) (fig.

3). Statistically the differences were significant (P≤0.05).

Mig

ra

tio

n p

ote

ntia

l

UC

B M

SC

s

PT

MS

Cs

0 . 0

0 . 1

0 . 2

0 . 3

0 . 4

0 . 5

Fig. 3. Migration potential (mm

2)

To evaluate the differentiation potential the cells at the 6th passages were

differentiated into adipogenic, osteogenic and chondrogenic lineages. The osteogenic differentiation was evident after 10-14 days of incubation with osteogenic induction medium. The numbers of osteogenic nodules in umbilical cord blood derived cultures were higher compared with palatal tissue derived cultures. Similarly, the number of Oil Red positive lipid droplets was higher and more evident in cord blood derived cultures. The presences of chondrocytes were revealed by Alcian Blue staining.

Our study demonstrated the presence of multipotent cells in both palatal tissue and umbilical cord blood. Umbilical cord blood MSCs shown higher proliferation capacity but no phenotypic and morphological differences were observed. The number of colony forming unit-fibroblast for umbilical cord blood derived MSCs was significantly higher than that of palatal tissue derived cells. A


152

higher population doubling time and reduced migration potential were recorded in palatal tissue derived cells, but both cell lines demonstred trilineage potential after 21-28 days of induction (fig. 4).

Fig. 4. Differentiation assay – A, B- Osteogenic nodules, C- chondrogenic

differentiation, Alcian Blue staining, D- adipogenic differentiation

Our data confirm the results of previous studies regarding the characteristics of MSCs from UCB and their differentiation potential (22). Mesencymal stem cells represented a potential source for cell therapy, because they can be easily isolated from different tissue, cultured, and transfected with exogenous genes (10,17,19, 21). Umbilical cord blood is a rich source of hematopoietic and mesencymal stem cells and has been used successfully as an important source of cells for treatment of malignant and non-malignant hematopoietic and non-hematopoietic diseases (1). The collections of samples can be obtained using painless procedure and the cells have faster self-renewal properties and can differentiate into the three germ layers that promote tissue repair (4). MSCs from palatal tissue also represent a good source of stem cells, but for the isolation of these cells are required invasive isolation procedures. Despite that, these cells represents a novel sources of stem cells by being their differentiation ability in odontogenic, osteogenic, neurogenic, adipogenic, chondrogenic, hepatogenic lineages and also insulin-producing cells (25).


153

Conclusions

In conclusion our results indicated a higher proliferation and differentiation capacity of umbilical cord blood MSCs compared with palatal tissue stem cells. Considering the easy access to samples for stem cell isolation, the higher self-renewal capacities of isolated cells, the umbilical cord blood may provide an excellent alternative source of cells for research and therapy.

Acknowledgements

This paper was published under the frame of European Social Fund, Human Resources Development Operational Programme 2007-2013, project no. POSDRU/159/1.5/S/138776.

References

1. Bongso, A., Fong, Cy., The therapeutic potential, challenges and future clinical directions os stem cells from Wharton s Jelly of the human umbilical cord, Stem Cell Rev, 2013, 9(2), 226-40.

2. Chamberlain, G., Fox, J., Ashton, B., Middleton, J., Concise review: mesenchymal stem cells: their phenotype, differentiation capacity, immunological features, and potential for homing, Stem Cells 2007, 25, 2739-2749.

3. Colter, D.C., Class, R., DiGirolamo, C.M., Prockop, D.J., Rapid expansion of recycling stem cells in cultures of plastic-adherent cells from human bone marrow, Proc Natl Acad Sci USA. 2000, 97, 3213–18.

4. Ding, D.C., Chang, Y.H., Shyu, W.C., Lin, S.Z., Human umbilical cord mesenchymal stem cells: a new era for stem cell therapy Cell Transplant, 2015 Jan 23.

5. Gonzalez, R.E., Gonzalez, M.A., Varela, N., Human adipose-derived mesenchymal stem cells reduce inflammatory and T cell responses and induce regulatory T cellsin vitroin rheumatoid arthritis, Ann Rheum Dis, 2010, 69, 241–248.

6. Gronthos, S., Mankani, M., Brahim, J, Postnatal human dental pulp stem cells (DPSCs), Proc Natl Acad Sci, 2000, 97, 13625–13630.

7. Kim, H.R., Mehrazarin, S., Kang, M.K., Therapeutic Potential of Mesenchymal Stem Cells for Oral and Systemic Diseases, Dent Clin North Am, 2012, 56(3), 651–675.

8. Kim, N., Cho, S-G., Clinical applications of mesenchymal stem cells, The Korean Journal of Internal Medicine, 2013, 4, 28.

9. Ma, J., Both, S.K., Ji, W., Yang, F., Prins, H-J., Helder, M.N., Pan, J., Cui, F-Z., Jansen, J.A., van den Beucken, J.J.P., Adipose tissue-derived mesenchymal stem cells as monocultures or cocultures with human


154

umbilical vein endothelial cells: Performance in vitro and in rat cranial defects, J Biomed Mater Res Part A 2014, 102A,1026–1036.

10. Marrelli, M., Paduano,F., Tatullo, M., Cells Isolated from Human Periapical Cysts Express Mesenchymal Stem Cell-like Properties, Int J Biol Sci, 2013, 9(10), 1070–1078.

11. Mennan, C., Wight, K., Bhattacharjee, A., Balain, B., Richardson, J., Roberts, S., Isolation and Characterisation of Mesenchymal Stem Cells from Different Regions of the Human Umbilical Cord BioMed Research International, 2013, 8.

12. Miura, M., Gronthos, S., Zhao, M., SHED: stem cells from human exfoliated teeth, Proc Natl Acad Sci, 2003, 100, 5807–5812.

13. Muraglia, A., Cancedda, R. & Quarto, R, Clonal mesenchymal progenitors from human bone marrow differentiate in vitro according to a hierarchical model, J Cell Sci, 2000, 113, 1161.

14. Nöth, U., Rackwitz, L., Steinert, A.F., Tuan, R.S., Cell delivery therapeutics for musculoskeletal regeneration, Adv Drug Deliv Rev, 2010, 62,765-783.

15. Nowak, J.A., Polak, L., Pasolli, H.A., et al., Hair Follicle Stem Cells Are Specified and Function in Early Skin Morphogenesis. Cell Stem Cell, 2008,3, 33–43.

16. Parekkadan, B., Milwid, M.J., Mesenchymal Stem Cells as Therapeutics, Annu Rev Biomed Eng. 2010, 15, 12, 87–117.

17. Park, J-C., Kim, J-M., Jung, I-H., Kim, J.C., Choi, S-H., Cho, K-S., Kim, C-S., Isolation and characterization of human periodontal ligament (PDL) stem cells (PDLSCs) from the inflamed PDL tissue: in vitro and in vivo evaluations, J Clin Periodontol, 2011, 38, 721–731.

18. Sekiya, I., Larson, B.L., Smith, J.R., Pochampally, R., Cui, J.G., Prockop, D.J., Expansion of human adult stem cells from bone marrow stroma: conditions that maximize the yields of early progenitors and evaluate their quality. Stem Cells, 2002, 20,530–41.

19. Seo, B.M., Miura, M., Gronthos, S., et al., Investigation of multipotent postnatal stem cells from human periodontal ligament, Lancet, 2004, 364,149–155.

20. Sonoyama, W., Liu, Yi., Fang, D., et al., Mesenchymal stem cell mediated functional tooth regeneration in swine, PLoS One, 2006; 1:e79.

21. Sukhikh, G.T., Malaitsev, V.V., Bogdanova, I.M., Dubrovina, I.V., Mesenchymal Stem Cells, Bulletin of Experimental Biology and Medicine, 2002, 133, 2.

22. Toai, T.C., Thao, H.D., Thao, N.P., Gargiulo, C., Ngoc, P.K., Hung Van, P., Michael, S.D., In vitro culture and differentiation of osteoblasts from human umbilical cord blood, Cell Tissue Bank, 2009, DOI 10.1007/s10561-009-9141-4


155

23. Ullah I., Subbarao B.R., Rho G-J., Human Mesenchymal Stem Cells - Current trends and future prospective, Bioscience Reports, 2015, doi: 10.1042/BSR20150025.

24. Yang, S., Huang, S., Feng, C., Umbilical cord-derived mesenchymal stem cells: strategies, challenges, and potential for cutaneous regeneration, Front Med, 2012; 6:41–47.

25. Zhou, Y., Xu, X., Zheng, L., Zhou, X., Li, J., Dental Mesenchymal Stem Cells in Inflamed Microenvironment: Potentials and Challenges for Regeneration, Curr Stem Cell Res Ther, 2015 Mar 11.


156

A STUDY REGARDING ANTIMULLERIAN FACTOR’S ACTIVITY IN BASSET HOUND PUPPY MALES YOUNGER THAN 120 DAYS

A.R. POP1, ALEXANDRA IRIMIE², O. HENEGARIU

3, A. DAMIAN

2, I. Ş. GROZA¹

1Clinical Reproduction Department. University of Agricultural Sciences and Veterinary Medicine, 400372, Calea Manastur Street, no.3-5, Cluj-Napoca 2Pathology Department. University of Agricultural Sciences and Veterinary

Medicine, Cluj-Napoca, Romania 3Neurosurgery and Genetics Departament. Yale School of Medicine, New Haven,

USA E-mail: [email protected]

Summary

Persistant müllerian duct syndrome (PMDS) is a congenital disease, frequent in many breeds (especialy miniature schnauzers and basset hounds) and is defined by the presence of the body, uterine horns and oviducts (in some cases), in fertile males. In most cases, PMDS evolving subclinical thus difficult to suspected in the absence of obvious characteristic symptoms. Antimullerian Hormone (AMH) - a family member transforming growth factor β (TGF-β), is known primarily for its role in regulating the differentiation of male embryonic period. Thus, the hormone produced by Sertoli cells, induces regression of fetal műllerian ducts, primordial elements of the female reproductive tract and thereby contributes to the normal development of male genitalia. The aim of this study was to evaluate the AMH activity in the first 120 days of life in basset hound puppy males suspected being affected by PMDS. The study was conducted on 9 male canine patients, pure breed Basset Hound. Age subjects of this study were 8 weeks for five individuals and five weeks for the rest of them. Blood samples without anticoagulant were taken in vacutainers without cloat activator and serum was separated by centrifugation. All samples were analyzed on the day of harvest. In order to establish AMH concentration in subjects included in the study, we used immunochemical methods of analysis electrochemiluminescence (ECLIA). US in B-Mode: all underwent ultrasound males after the age of one year (minimum age required for the realization of diagnostic imaging PMDS), in order to establish the status of the subjects included in the study. Analyzing data obtained from the determination of serum AMH we observed a significant variation in the level of activity of this factor, the values were between 12.8 respectively 114.3 ng / ml serum.The mean value was 49,14 ng/ml serum. Of the nine males examined, one of them was diagnosed positive during by ultrasound exam. Uterine body and the rudiments of uterine horns located on the medial aspect of the vas deferens were identified. In this male also found low activity AMH serum concentration was below the limit of 15 ng / ml (12.8 ng / ml).AMH causes apoptosis of specific Anti-Müllerian inhibiting substance (MIS) receptor-bearing cells, while having no effect on cells without receptors. In dogs, inadequate embryonal AMH activity can lead to the Persistant Műllerian duct Syndrome (PMDS), in which a rudimentary uterus is present and testes are usually undescended. The AMH gene (AMH) or the gene for its receptor (AMH-RII) is usually abnormal. AMH measurements have also

become widely used in the evaluation of testicular presence and function in infants with intersex conditions and cryptorchidism.

Keywords: antimullerian hormone, persistant mullerian duct syndrome, dog


157

Persistant müllerian duct syndrome (PMDS) is a congenital disease, quite frequent in many breeds (Miniature Schnauzers, Labradors, German Sheperd and Basset Hound) and is defined by the presence of the body, uterine horns and oviducts (in some cases), in fertile males. In most cases, PMDS evolving subclinical thus difficult to suspected in the absence of obvious characteristic symptoms. Antiműllerian Hormone (AMH), a family member transforming growth factor β (TGF-β), is known primarily for its role in regulating the differentiation of male embryonic period (3). Thus, the AMH is produced by Sertoli cells induce regression of fetal műllerian ducts, primordial elements of the female reproductive tract and thereby contributes to the normal development of male genitalia (1).

The aim of this study was to evaluate the AMH activity in the first 120 days of life in basset hound puppy males suspected being affected by PMDS.


The study was conducted on 9 male patient's canine, pure breed Basset

Hound. Age subjects of this study were 8 weeks for five individuals and five weeks for the rest of them.

Blood samples were taken in vacutainers without cloat activator and serum was separated by centrifugation. All samples were analyzed on the same day of harvesting.

In order to establish AMH serum concentration in subjects included in the study, we used immunochemical methods of analysis electro-chemiluminescence (ECLIA).

Ultrasound exam in B-Mode: all underwent ultrasound males after the age of one year (minimum age required for the realization of diagnostic imaging PMDS), in order to establish the status of the subjects included in the study. Since ultrasound diagnosis of PMDS require great accuracy due to the position and size of rudimentary uterine body and horns, patients included in the study underwent a protocol of neurolept-analgesia with diazepam (0.5 mg/kg) and ketamine (7-10 mg/kg).

Ultrasound diagnosis of PMDS require initial identification of the male prostate (located posterior to the bladder, early in the membranous portion of urethra) preferably using a sector probe, using a variable frequency range 6.5 and 8 MHz. The dorsal prostatic vas deferens is observed having a diameter of about 3 mm, depending on the size of the patient and a slightly hyper-echoic due to increased molecular cohesion of the connective tissue rich in collagen fibers and elastic fibers. Vas deferens are arranged in the shape of the letter "V" and are joined at the base by an inter-deferential ligament. On the medial side of the vas deferens is observed testicular artery, vein and lymphatic vessel having a weak echogenic appearance (fig.2). Testicular artery is easily identified due to characteristic pulsations. Viewing, identification and differentiation of the two


158

structures is based on their echogenicity. Rudiments of uterine body and horns projected onto the front medial vas deferens.


Analyzing data obtained from the determination of serum AMH we observed a significant variation in the level of activity of this factor, the values were between 12.8 respectively 114.3 ng/ml serum. The mean value was 49.14 ng/ml serum.

Table 1 The AMH levels obtained

Case no. AMH level (ng/ml)

1 32.7

2 57.8

3 28.4

4 19.81

5 114.3

6 76.42

7 41.6

8 58.4

9 12.8

Mean Value 49.14

Fig.1. The level of activity of AMH


159

Fig.2. A. Prostate; B. Urethra; C. Testicular artery

Of the nine males examined, one of them was diagnosed positive during by

ultrasound exam. Uterine body and the rudiments of uterine horns located on the medial aspect of the vas deferens were identified (fig. 3).

Fig. 3. PMDS positive Basset Hound breed male. A. Prostate;

B. Vas Deference; C. Uterine body; D. Uterine horns In this male also found low activity AMH serum concentration was below

the limit of 15 ng / ml (12.8 ng / ml). AMH causes apoptosis of specific Anti-Müllerian inhibiting substance (MIS) receptor-bearing cells, while having no effect on cells without receptors. According to similar studies on different species of mammals AMH concentration in physiological average first 120 days of life is between 15 and 500 ng / ml serum (4).


160

Conclusions

In dogs, inadequate embryonic AMH activity can lead to the Persistant Műllerian duct Syndrome (PMDS), in which a rudimentary uterus is present and testes are usually undescended. The AMH gene (AMH) or the gene for its receptor (AMH-RII) is usually abnormal. AMH measurements have also become widely used in the evaluation of testicular presence and function in infants with intersex conditions and cryptorchidism.

The association of AMH dosage (in the first 120 days of life) and ultrasound (performed after the age of one year) will increase the likelihood of diagnosing a significant number of affected male by PMDS, their exclusion from the kennels breeding program will, in time a reduction in the prevalence of this disease in canine flocks.

Further research is needed on the identification of the mutation responsible for the appearance PMDS and production of specific primers for the standardization of a molecular diagnostic test, is the basic solution in controlling and eradicating this disease hereditary.

Acknowledgments

This paper was published under the frame of European Social Fund,

Human Resources Development Operational Programme 2007-2013, project no. POSDRU/159/1.5/S/136893.

References

1. Belville, C., Josso, N., Picard, J.Y., Persistence of Müllerian derivatives

in males, American Journal of Medical Genetics, 1999, 89 (4), 218–223 2. Matsuu, A., Hashizume, T., Kanda, K., Nagano, M., Sugiyama, A., et al.,

A case of persistent Müllerian duct syndrome with Sertoli cell tumor and hydrometra in a dog, J Vet Med Sci, 2009, 71, 379–381.

3. Rey, R., Lukas-Croisier, C., Lasala, C., Bedecarrás, P., AMH/MIS: what we know already about the gene, the protein and its regulation, Molecular and Cellular Endocrinology, 2003, 211 (1-2), 21–31.

4. Weenen, C., Laven, J.S., Von Bergh, A.R., Cranfield, M., Groome. N.P., Visser. J.A., et al., Anti-Müllerian hormone expression pattern in the human ovary: potential implications for initial and cyclic follicle recruitment, Molecular Human Reproduction, 2004, 10 (2), 77–83.


161

REACTION TO HUMANS IN TETHERED STALLIONS USING QUALITATIVE BEHAVIOURAL ASSESSMENT

SILVANA POPESCU, CRISTIN BORDA, EVA ANDREA DIUGAN, DANIELA

OROS, REBECCA GRATZIELLA VLAIC

Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary

Medicine, 400372, Manastur street, no. 3-5, Cluj-Napoca, Romania E-mail: [email protected]

Summary

Qualitative Behaviour Assessment uses qualifying terms to describe how the

animal interacts with the environment in certain situations, considering that the dynamic style (body language) adopted reflects the animals‟ previous experiences. This type of assessment is more difficult if the animals‟ reactions are restricted by tethering, but using well-defined descriptors it is possible. The aim of this study was to reveal if there are breed related differences regarding the reactions towards familiar and unfamiliar humans in stallions housed in tethered conditions. A total number of 34 stallions were assessed, comprising 16 Lipizzaner and 18 Romanian draft horses. All the stallions were managed in similar environmental conditions, being housed in the same barn of the same farm. A standardized assessment protocol was designed for the study, employing predefined descriptors in order to qualify the stallions‟ reactions. Even if not statistically significant, several differences were found in the stallions‟ human related reactivity, depending on their breed and especially on familiarity to the person involved in their testing. The results of the study suggest that the horses‟ welfare quality can be improved by achieving a better human-animal relation. Moreover, this study proves that the behavioural responses of the horses towards humans can be recognized even if the animals are restricted by tethering.

Key words: qualitative behavioural assessment (QBA), human-animal relationship

(HAR), stallions, tethered housing

Qualitative Behaviour Assessment (QBA) became lately a method to

assess animal welfare through observation of animal body language (1). This assessment tool represents an integrated evaluation of the whole animal where the body language is considered as an indication of the animal welfare state (10). Instead of the initial variants based on Free Choice Profiling (recording of spontaneous judgments assigned mostly by untrained personnel), the more systematic versions of QBA use previously established descriptors that are scored employing a Visual Analogue Scale (VAS), as presented in the Welfare Quality® assessment protocols (9, 11). The QBA was validated in many animal species, including horses (5) and it was recently used even for the description of the stockpersons‟ behaviour as a novel way of characterizing handling styles (1). Usually, the QBA relies on the inspection of animals allowed to move freely. Yet, it can be considered that with careful observation and if the descriptors are extensively and precisely explained, the assessment would be possible even in


162

situations when the animals‟ natural movements are restricted, by tethering for example. Although the tie stall housing in horses is controversial from the animal welfare point of view, this type of accommodation is still used in many countries and seems to be even beneficial in eliminating some unwanted behaviours in stallions, such as self-mutilation (4).

The aim of this study was to reveal if there are breed related differences regarding the reactions towards familiar and unfamiliar humans in stallions housed in tethered conditions. In this context, the QBA was used to assess the human-animal relationship (HAR).


The study was conducted in a stud-farm, breeding Lipizzaner and

Romanian draft horses, in 2014. The selection of the farm and timing of the visits were based on the accessibility of the location, the number of animals, the acceptance of the responsible personnel to take part in the study and the availability of the stockpersons to help in the evaluation process.

A total number of 34 stallions were assessed (16 Lipizzaner and 18 Romanian draft horses), all the animals being tethered with two ropes, in the barn. All the assessments were performed by two persons: one of them was testing the animal and the other was observing and recording the results. The testing person was approaching the stallion in an angle of appreciatively 45° to his shoulder and said the word „accept‟ until it was sure that the animal noticed the human presence. Than the testing person advanced near the stallion, facing the wall in front of the animal, keeping a distance of about 40 cm (not touching the animal), making a medium step at two seconds. In line with the stallion‟s shoulder, the person stopped, saying the word „bravo‟. Without trying to establish eye contact with the animal, the testing person turned, facing the stallion, and raised a cupped hand in the direction of his chin, at about 20 cm, but without touching it. If the stallion approached or touched the human by his will, it was not stopped (excepting the aggressive approach), but otherwise no human-animal physical contact was forced.

The testing person stayed motionless during 15 seconds, than moved back. The observer recorded the behavioural response of each stallion, using a VAS for each of the six predefined descriptors (Table 1). The assessment for each stallion was repeated similarly with a familiar person (stockman) and an unfamiliar one. The participating testing persons were instructed previously and performed 10 times the testing procedure being watched and instructed further, as it was needed, by the observer (one of the authors). The horses used for the preliminary 10 assessments did not participate in the study. The time interval between the two successive assessments (performed by the familiar and the unfamiliar human) was about five hours and took place after about one hour the stallions were fed (with hay). The access of the animals to water was continuous, as the farm is equipped with automatic waterers.


163

Table 1 The describers used to score the behavioural response of the stallions

towards humans

No. Descriptor Significance of the descriptor

1. Friendly The animal interacts positively with the human. The stallion is attentive, possibly curious, and initiates physical contact, especially by touching the raised human hand with the nose. The muscles of the neck and body are relaxed; the head and ears of the animal are pointed towards the human.

2. Immobile/relaxed The animal stays motionless in the presence of the human. The muscles of the body and neck, the position of its body are relaxed, the ears are pointed towards the human, and the stallion does not show any signs of tension. The animal may be preoccupied by something else (eating, for example) or it may snooze.

3. Immobile/tensed The animal stays motionless in the presence of the human. The muscles of the body and neck are contracted; the position of its body is tensed. The head is raised with erect or laid-back ears, the eyes may be opened wide. The animal does not approach the human, nor retreats. The head points forward, not in the direction of the human, nor in the opposite direction.

4. Avoidant, frightened

The animal tries to avoid the human. The head is turned in the opposite direction. It may try to retreat, making a step in the opposite direction. The muscles of the body and neck can be tensed, the eyes are wide open, the stallion may snuffle.

5. Aggressive The animal threatens the human or tries to attack. The ears are laid back, pinned to the head and the stallion does at least one threatening movement towards the human, trying to bit or kick.

6. Apathetic The animal is depressed, tending still in the presence of the human and is obviously distressed. The head is lowered, the eyes may be half-closed, and the body position suggests lack of interest to the environment. The stallion does not respond to the usual environmental stimuli and may present clinical signs of some health problems.

Using the VAS each body language descriptor was scored for each animal,

drawing a line across a 125 mm scale, at the appropriate point, as instructed in the Welfare Quality® assessment protocols (9, 11). This way the results were


164

expressed numerically (from 0 to 125, the distance in millimeters from the minimum point of the VAS to the point where the line crosses the scale). These results were processed statistically, using the SPSS (version 17) statistical software. For the comparison of the values obtained the Mann-Whitney test or the t test was used, depending on the distribution of the data. The differences were considered statistically significant if P<0.05.


In order to compare the differences in the stallions‟ reactions towards

familiar and unfamiliar humans, the proportion of each descriptor was calculated in the two successive test conditions. For each descriptor the score of at least 100 (100 millimeters from the minimum point of the VAS) was taken into consideration, as being significant for that descriptor. Figure 1 presents the graphic representation of these results.

0

10

20

30

40

50

60

70

80

F I/T I/R A/F

Pro

po

rtio

n o

f st

alli

on

s (%

)

Familiar human Unfamiliar human

F: friendly; I/T: Immobile/tensed; I/R: Immobile/relaxed; A/F: Avoidant/frightened

Fig.1. The comparative representation of the assessed stallions‟ behavioural reactions towards the familiar and unfamiliar human

Even if it can be observed that a higher proportion of the stallions reacted

friendly and immobile/relaxed towards the familiar human comparing the unfamiliar person and they were less tensed or frightened in the presence of the human they knew, the differences were not statistically significant (P>0.05). A hopeful finding of this study was that in the assessed farm, none of the stallions reacted aggressively towards humans and none of them was apathetic. Several recent studies (6, 7) show that the recognition of humans by horses is based on a global, integrated, multisensory representation of a specific person. This representation includes the visual and vocal identity of the human and the expectance of his/her behaviour in a


165

familiar situation. By recognition of the familiar person, the horses‟ expectances should be neutral or positive if these are based on a positive human-animal relation (horsemanship). The high percentage of the friendly responses towards people in the studied stallions and the low occurrence of avoidance or tensed reactions may prove that in the studied farm the stockpersons‟ behaviour did not represent a dangerous or frightening experience in the stallions‟ perception.

The ability of horses to perform superior cognitive processes, such as generalization was highlighted by Hanggi (2). The high generalization ability of horses (i.e. extrapolating expectances) may explain the absence of statistically significant differences in the stallions‟ behavioral responses towards the familiar and unfamiliar people in the present study. Based on these results the importance of good horsemanship can be underlined, as being an essential element in increasing human safety when working with horses in any conditions.

Comparing the human related reactions of the stallions considered by breed, the results were homogenous. The only observable, but yet not statistically significant (P>0.05) difference was the higher proportion of the immobile/relaxed attitude of the Romanian draft stallions comparing with the Lipizzaners, in the proximity of the unfamiliar human than the familiar one (Fig.2).

A

0

10

20

30

40

50

60

70

80

F I/T I/R A/F

Pro

po

rti

on

of

sta

llio

ns (

%)

Lipizzaner Romanian draft horse

B

0

10

20

30

40

50

60

70

F I/T I/R A/F

Pro

po

rtio

n o

f s

ta

llio

ns

(%

)

Lipizzaner Romanian draft horse

F: friendly; I/T: Immobile/tensed; I/R: Immobile/relaxed; A/F: Avoidant/frightened

Fig.1. The comparative representation of the behavioural reaction towards the familiar (A) and unfamiliar (B) human in the Lipizzaner and Romanian draft stallions

Comparing the human related reactivity in different horse breeds Hayes (3) found differences, but generally these were temperamentally different horse breeds (8). Another aspect to consider is that the Romanian draft horse is a half-heavy breed, having Ardennes stallions in their ancestry, which may give a more cold-blooded temperament to these individuals. Taking into account the fact that all the stallions were kept in very similar conditions, the results of the study may show that the influence of the environment on the human related behaviour of the horses may be crucial. This finding worth investigating because it may be a key element in


166

increasing the working effectiveness and safety for the people involved in horse breeding.

Conclusions

The results of the present study suggest that the horses‟ welfare quality

can be improved by achieving a better human-animal relation in everyday working with these animals, especially stallions. Moreover, by promoting a high quality HAR in stud farms the safety and working effectiveness of the employed personnel could be further increased.

References

1. Ellingsen, K., Coleman, G.J., Lund, V., Mejdell, C.M., Using qualitative

behaviour assessment to explore the link between stockperson behaviour and dairy calf behaviour, Appl Anim Behav Sci, 2014, 153, 10-17.

2. Hanggi, E.B., The thinking horse: cognition and perception reviewed, Proceedings of the 51

st American Association of Equine Practitioners

Annual Convention, Seattle, 2005, 51, 246-255. 3. Hayes, K., Temperament tip-offs, Horse and Rider, 1998, 11, 47-84. 4. McDonnell, S.M., Practical review of self-mutilation in horses, Anim

Reprod Sci, 2008, 107, 219-228. 5. Napolitano, F., De Rosa, G., Braghieri, A., Grasso, F., Bordi, A.,

Wemelsfelder, F., The qualitative assessment of responsiveness to environmental challenge in horses and ponies, Appl Anim Behav Sci, 2008, 109, 342-354.

6. Proops, L., McComb, K., Cross-modal individual recognition in domestic horses (Equus caballus) extends to familiar humans, Proceedings of the Royal Society, B, Biological Sciences, 2012, 1-8.

7. Sankey, C., Henry, S., Andre, N., Richard-Yris, M.A., Hausberger, M., Do horses have a concept of a person?, PlosOne, 2011, 6(3), e18331.

8. Skipper, L., Understanding horse behaviour, New Holland Publisher, 2007, 144.

9. Welfare Quality, An overview of the development of the welfare quality assessment systems. In: Keeling, L. (Ed.), Welfare Quality Reports No.12, 2009, Cardiff University, U.K.

10. Wemelsfelder, F., Lawrence, A.B., Qualitative assessment of animal behaviour as an on-farm welfare-monitoring tool, Acta Agric Scand, Sect A, 2001, 51, 21-25.

11. Wemelsfelder, F., Millard, F., Rosa, G.D., Napolitano, F., Qualitative behaviour assessment. In: Forkman, B., Keeling, L. (Eds.), Assessment of animal welfare measures for dairy cattle, beef bulls and veal calves. Cardiff University, U.K., 2009, 215-224.


167

VETERINARY RECORDS AND OWNERS PERCEIVED HEALTH PROBLEMS IN HORSES: AN EPIDEMIOLOGICAL STUDY

SILVANA POPESCU, CRISTIN BORDA, DANIELA OROS,

EVA ANDREA DIUGAN

Faculty of Veterinary Medicine, University of Agricultural Sciences and Veterinary

Medicine, 400372, Manastur street, no. 3-5, Cluj-Napoca, Romania E-mail: [email protected]

Summary

The epidemiological study represents an important tool in all the veterinary

databases worldwide. The aim of this study was to compare the evidences recorded in veterinary registers with the perception of the horse owners, regarding the health problems of their animals during one year. The records of a veterinary practice were consulted and all the data about treatments applied to horses during the past year were grouped by disease diagnostics and also by treatment length. Using a questionnaire, the horse owners in the same veterinary practice were asked to remember and declare all the treatments applied by the veterinarian to alleviate the health problems of their animals in the past year. The prevalence of certain diseases and the duration of the necessary treatments were calculated from the veterinary record and from the declarations of the horse owners, than the obtained data were compared. This procedure revealed significant differences between the two different data sets. Besides these results, the paper also discusses the possible reasons for the differences obtained. The information gathered by this study, the first one of this type in Romania in our knowledge, can present an indication on the perception of horse owners regarding the disease episodes experimented by their horses.

Key words: horses, disease prevalence, veterinary records, questionnaire

Veterinarians and animal owners have in common the interest in caring for

animals, improving their welfare and living conditions, alleviating their health problems and preventing their disease states. Depending on the situation, the economical reasons can weight more or less in taking decisions and managing especially the food-producing animals. Normally the owners‟ (or stockpersons‟) perception regarding their animals‟ health and welfare status should be a quite precise assessment tool, even if the majority of them are laypersons concerning veterinary medicine. People taking daily care of their animals have the advantage of being familiar with their livestock‟s behaviour and should notice any disturbances occurring. Comparing with the caregivers of other animal species, those working with horses in Romania should be even more aware of the possible health problems in their animals, considering that they usually have only a few horses in their care (6) and have a closer human-animal relation (HAR) with these than with cattle for example. One proof of this fact is that in the majority of cases in Romania horses do have a given name (inscribed in the equine passport), but for cattle they do not. Communicating correctly the general history of the disease states of the


168

horses may help the veterinarians when consulting the equine patient. Moreover, if the persons responsible for a horse are aware of illness antecedents of the animal, this may improve their quality of care in order to prevent other health issues and help to cure present ones. According to McIlwraith and Rollin (3), horse owners and caretakers have the responsibility for appropriate monitoring of horses in their care. In the same time, someone capable of identifying signs of disease, in order to be efficient, must do this monitoring. Yet, as other studies show (6), the farmers‟ estimates regarding a health or welfare issues of their animals can significantly differ from the scientifically recorded data.

The aim of this study was to compare the evidences recorded in veterinary registers with the perception of the horse owners, regarding the health problems of their animals during one year.


The records of a veterinary practice were consulted and all the data about

treatments applied to horses during one calendar year (2014) were grouped by disease diagnostic and by treatment length. The veterinary practice included a maximum number of 243 and a minimum of 218 horses during the considered year. According to the length of the clinical disease, necessity of treatments and ability of healing or not (including the death of the horse) some clinical diseases or syndromes were classified as severe or mild and considered separately. After data extraction from the veterinary records, the prevalence of each health issue was established.

In the next phase all the horse owners in the veterinary practice (who had at least one horse during the study‟s period of interest) were visited and asked to respond to a questionnaire regarding the health problems and veterinary care needed by their horses during the same calendar year (2014). To be included in the questionnaire only that health issues were taken into consideration, which needed veterinary attention/care. The short description of these is presented in table 1. All the respondents had to agree to take part in the study and they were not remunerated in any way. The questionnaire was unstructured and open ended, so that the respondent could express and describe the past health problems of his/her horse without needing a professional veterinary language. A total number of 207 completed questionnaires were included in the study.

The data sets from the veterinary records were compared with the answers of the questionnaires, using the Kruskal-Wallis test with Dunn‟s multiple comparison post-test when the data sets did not pass the normality test and the Tukey-Kramer multiple comparisons test for the parametric data sets. The differences were considered significant when P<0.05.


169

Table 1 The health issues of the horses recorded by the veterinarian and described

by the horse owners No. Health issue of the horse Description

1. Severe colic Colic syndrome that does not resolve in a maximum interval of 6 hours with the use of antispasmodic and analgesic medication or recidivates after a temporary resolution period, in less than 24 hours

2. Mild colic Colic syndrome that resolves in a maximum interval of 6 hours with the use of antispasmodic and analgesic medication and does not recidivate in less than 24 hour

3. Enteritis in foals, enteritis in adult horses

Clinical diarrheic syndrome with or without the alteration of the animal‟s general status

4. Lameness Mild to severe avoidance to bear weight on a leg, producing abnormal gait or stance. Includes only the clinical lameness that was not exactly diagnosed as arthritis, tendinitis, laminitis, hoof abscesses, traumatic lesions of the legs including traumatic swellings

5. Arthritis, polyarthritis A possible cause of lameness, with swelling of a joint or diagnostic of joint cartilage degenerescence/wearing.

6. Tendinitis A possible cause of lameness with local swelling so that the tendons can not be palpated individually

7. Laminitis Inflammation of the laminar tissue in the hoof capsule, with characteristic clinical stance, reluctance to move, warming of the hoof/coronary band and accentuated pulsation of the digital arteries

8. Pastern dermatitis A cutaneous reaction pattern with multiple possible etiologies in the pastern region, with edema, erythema, scaling, progressing to exudation and crusting

9. Hoof abscess A cause of acute lameness, with the discovering of a localized accumulation of purulent exudate

10. Infected traumatic lesions Traumatic disruption of the skin layer that presents a purulent exudate

11. Fresh traumatic lesions Traumatic disruption of the skin layer have not occurred earlier than 24 hours and does not presents a purulent exudate

12. Pulmonary emphysema/recurrent airway obstruction

Clinical signs of dyspnea (hampered respiration), without fever, and specific sounds at stethoscope auscultation

13. Cachexia/extreme weight loss

Established by inspection and palpation

14. Rhabdomyolysis (tying-up)

Irrespective to the etiology (exertional or polysaccharide storage myopathy), clinical manifestations of stiffness (muscle rigidity), reluctance to move, pain related behaviours, discoloration of the urine

15. External parasites Identification of any external parasites


170

Results and discussions The differences between the prevalence of diseases in horses recorded

officially by the veterinarian and declared by the owners are presented in Table 2.

Table 2 Statistical differences and their significance between the prevalence of horse health problems recorded by the veterinarian and described by the owner for

one year period

No. Health issue of the horse Prevalence recorded by the

veterinarian (%)

Prevalence declared by

the owner (%)

Significance of difference

(P)

1. Severe colic 8.69 11.59 <0.01

2. Mild colic 12.08 14.98 <0.01

3. Enteritis in foals, enteritis in adult horses

5.8 7.73 <0.05

4. Lameness 50.24 27.05 <0.001

5. Arthritis, polyarthritis 30.43 26.57 ns

6. Tendinitis 21.74 16.91 <0.01

7. Laminitis 2.42 1.93 ns

8. Pastern dermatitis 9.66 10.63 >0.05

9. Hoof abscess 2.9 2.41 >0.05

10. Infected traumatic lesions 8.7 11.59 <0.05

11. Fresh traumatic lesions 3.86 5.31 ns

12. Pulmonary emphysema/recurrent airway obstruction

6.76 7.25 ns

13. Cachexia/extreme weight loss

3.86 4.35 ns

14. Rhabdomyolysis (tying-up)

12.08 14.49 <0.05

15. External parasites 5.8 9.18 <0.01

P<0.05: statistically significant; ns: not significant As table 2 shows, the differences between the veterinary records and horse

owner descriptions were statistically significant for the more than half of the horse health issues considered (in ten cases of the overall 15). For some problems, the horse owners declared higher or lower occurrence than recorded by the veterinarian. For example, when they were asked about colic episodes in their horses, the owners remembered significantly higher numbers comparing with the official records (Table 2). The situation was the same regarding the traumatic lesions (fresh and infected). Based on similar findings Pearce (4) concludes that animal owners tend to


171

concentrate in a shorter period (the past year for example) all the happenings they remember from several years. This would explain the horse owners‟ exaggerated declarations in our study. Moreover, they seem to remember easier those problems that were severe, threatening the life of their horses, even if a long time passed by. Another possible explanation for the significantly higher colic prevalence declared by the owners compared to the veterinary records is the fact that part of the horses might recover without professional care (but the owner have not remembered later if the vet was called out or not). An interesting study (7) show that in the North-West of the UK only a little more than 50% of the horse owners would call a veterinary surgeon if they suspected colic and believed they could tell if the colic was getting better or worse. Some of the owners adopt the „wait and see‟ strategy or even initiate lay treatment, before seeking veterinary assistance. In a survey described by Tinker et al. (8) owners identified 30% of colic in their horses, but all were transient and resolved with owner treatment. Yet, the syndrome should not be overlooked, as it causes a reported mortality rate of about 20% (2).

Regarding the traumatic lesions in their horses, the owner declared prevalence may be real, but it is possible that they have not asked for veterinary care each time, forgetting later this aspect.

In opposition, when questioned about lameness (with different causes, excepting laminitis) in their horses, the owners declared fewer cases than recorded by the veterinarian. This might be caused by the fact that horse owners could forget those health problems in their animals that does not seem severe to them. In a study published by Ireland et al. (1) the authors conclude that the low prevalence and relatively poor agreement of owner-reported disease compared to that detected on veterinary examination suggests inaccurate reporting of health problems by owners of geriatric horses, which could lead to delay in presentation for veterinary treatment. For example, the same study notes that the clinical signs of lameness are under-reported by owners (present in 50% of the examined horses, reported by 23% of owners). Similarly, hoof abnormalities were detected in 80% of the assessed horses, but reported by 27% of owners only. The mentioned study (1) speaks about under-reporting health problems of the horses due to poor recognition of the clinical signs, and that it was possible also in the situation of the present research.

For some disease states in horses the differences were not statistically significant (P>0.05) when compared the prevalence recorded by the veterinarian and signaled by the owner. It seems that this accordance appeared in the first place in the case of chronic diseases of the horses, such as the pulmonary emphysema/recurrent airway obstruction. One possible reason for this is the persistence of the disease, its continuous character, the fact that it does not occur in several different episodes.

An interesting finding was that for laminitis the owners‟ declaration does not differ significantly from the veterinary records. A possible reason was the fact that the prevalence of laminitis was not high in the studied population and the owners of the involved horses remembered correctly the occurrence of the disease.


172

Similarly, in a survey performed by the United States Department of Agriculture (9) the owners reported in 13% of horse operation at least one case of laminitis during the previous 12 month, with 1% of horses affected at any one time.

Conclusions

The information gathered by this study, the first one of this type in Romania

in our knowledge, can present an indication on the perception of horse owners regarding the disease episodes experimented by their horses. If there would be more researches of this type, the data provided could be used as starting point in designing some educational programs to improve the knowledge and understanding of horse owners regarding the health and disease of this animal species.

References

1. Ireland, J.L., Cleqq, P.D., McGowan, C.M., McKane, S.A>, Chandler,

K.J., Pinchbeck, G.L., Comparison of owner-reported health problems with veterinary assessment of geriatric horses in the United Kingdom, Equine Vet J, 2012, 44(1), 94-100.

2. Leblond, A., Villard, I., Leblond, L., Sabatier P., Sasco, A.J., A retrospective evaluation of the causes of death of 448 insured French horses in 1995, 2000, Vet Res Commun, 24(2):85-102.

3. McIlwraith, C.W., Rollin, B.E., Horse welfare, UFAW Animal Welfare Series, Wiley Blackwell, 2011, 504.

4. Pearce, N., A short Introduction to epidemiology, Second edition, Centre for Public Health Research, Massey University, 2005, pp.153.

5. Popescu, S., Borda, C., Diugan, E., Popa, A., The prevalence of lameness in the assessment of Transylvanian dairy herds by locomotion score and according to the farmers‟ estimates, Scientific Works, Series C.

Veterinary Medicine, 2014, LX (2), 109-115. 6. Popescu, S., Diugan E.A., The relationship between behavioral and other

welfare indicators of working horses, J Equine Vet Sci, 2013, 33, 1-12. 7. Scantlebury, C.E., Perkins, E., Pinchbeck, G.L., Archer, D.C.,

Christley, R.M., Could it be colic? Horse-owner decision making and practices in response to equine colic, BMC Vet Res, 2014, 10(Suppl 1), S1.

8. Tinker, M.K., White, N.A., Lessard, P., Thatcher, C.D., Pelzer, K.D., Davis, B., Carmel, D.K., Prospective study of equine colic incidence and mortality, 1997, Equine Vet J, 29, 443-453.

9. USDA-ARS (United States Department of Agriculture, Agricultural Research Service), USDA National Nutrient Database for Standard Reference, 2000, Release 23.


173

GROSS ANATOMY OF DIGESTIVE SYSTEM IN EASTERN GREY KANGAROO (MACROPODIDAE FAMILY)

F. STAN

University of Agricultural Sciences and Veterinary Medicine of Cluj-Napoca, Faculty

of Veterinary Medicine, Mănăştur Street, No. 3-5, Cluj-Napoca, Romania E-mail: [email protected]

Summary

Mammal‟s millennial evolution led to adaptive anatomical changes of each species.

The main feature of marsupials is based on their particular reproductive system. Also, what differentiates from placental mammals is their digestive anatomy. The present research aims to provide a detailed morphological description of the digestive tract in kangaroo (Eastern grey kangaroo, Macropodidae family).

Kangaroos are strictly herbivores mammals. Oral cavity is characterized by the presence of three sets of upper incisors, dentition being of polyphyodont type. The slender, long esophagus presents longitudinal folds on its internal surface. The large stomach is the main component of digestive tract where microbial fermentation takes place. The stomach is divided in two distinct segments: anterior and posterior. The great curvature has a notched pattern and the small curvature is relatively flat. The first, anterior segment, more developed is composed from a small saccular segment, blind ended; “S” shaped which is separated from the posterior segment by an obvious fold. The posterior spiral segment has a storage function. External conformation is marked by the presence of three muscular bands which delimited correspondent haustra, giving the stomach “colon” like appearance. Small intestine is relatively long compare to the colon which has fewer and small haustra. The cecum is well defined In conclusion, even if the kangaroos share the same type of digestion with the ruminants, major differences exist in anterior digestive tract especially in stomach morphology. The anatomical particularities of digestive tract of kangaroos are the response of their needs to increase fiber digestibility for easy subsequent absorption of nutrients.

Key words: kangaroo, anatomy, digestive system

Marsupials represent one of the three subclasses of mammals that include prototherians (monotremes), metatherians (marsupials) and eutherians (placentals). The kangaroo is a marsupial from the family Macropodidae genus Macropus being one of the largest species of the family. The marsupial species that evolved in Australia are unique compared to the rest of the animal species due to the harsh and relative poor environment found on the continent. Marsupials are herbivorous animals that can be divided in two groups – foregut fermenters (the Macropodidae family –kangaroos and rat-kangaroos) and hindgut fermenters which include wombats, koala, several species of folivorous possums and gliders (4,5). Kangaroos have developed a number of adaptations to a dry, infertile land and a highly variable climate, from which the type of digestion is one of this adaptations. The environment specificities lead to adaptive anatomical amendments of the


174

digestive tract of this specie. The foregut fermentation has many advantages over hindgut fermentation in order to increase fiber digestibility and increase nutrient absorption. In this condition the kangaroos share the same pattern of digestion with the ruminants, compare to the hindgut fermenters like small animals as rabbits, chinchillas, guinea pigs (1,3,10,12) or colon fermenters as horses (14,16). The basis anatomy of the ruminant digestive system is very different from other mammals being specially designed to digest feeds high in cellulose. The ruminants are the main foregut fermenters with pregastric fermentation chambers - rumen, reticulum, omasum and true stomach-abomasum, dedicated to fibers digestions (2,6,7). To fulfill the digestion in foregut fermenters as cattle, sheep or wild ruminants this digestive segment gained a large size and specific compartments of the fermentation chambers compare to the rest of the digestive tract (2,13,14). The same pattern is found for example in horses in which the colon is the most developed segment or in rabbit in which the cecum has a considerable dimension (8,12,16). This paper provides a detailed anatomical description of the digestive system of kangaroo pointed out the basic morphological adaptation of the principal segments involved in digestion.


Two male kangaroos, which were brought from the zoo to our University for investigation related to respiratory disease, were studied. Right after the natural dead the gross dissection was performed. A midline abdominal wall incision along the white line was made on each animal and the abdominal content, the topography and the connection elements were observed and photographed in situ

using a Nikon D700 camera. The abdominal digestive tract was then removed and the peritoneal attachments were dissected for a proper visualization of the digestive tract components.


The overall dimension of the kangaroo head was very small compare to the body size. Oral cavity was elongated and the temporo mandibular articulation allowed sideways movement. The relative long tongue (Lingua) presented a slightly sharp apex and a well represented ventral fold which connect the tongue with the oral cavity floor. Dorsal protuberance was not evident, but an obvious median notch, (Sulcus medianus linguae) on the free segment of the tongue was noted. The smooth aspect of the tongue, due to the presence of lingual papillae (Papillae linguales), was noted. The circumvalate (Caliciformes papilles) were observed on the aboral segment of the tongue. The lips were slightly immobile presenting close to the commissural small conical papillae aboral oriented. The hard palate, narrowed in oral direction and slightly larger in aboral direction, presented eight or nine ridges (Crista palatina) with caudal opening of the first ridges between the


175

large diastema, and the last ridges between the molars, while the ridges between

the premolars had transversal position. Between the first palatal ridges the mucosa presented numerous, small conical excrescences protruding into oral cavity. Dental formula in examined subjects was 2X (I3/1 C0/0 P1/1 M4/4-5). The upper incisors (Dentes incisivi) were positioned in a continuous arched series, lateral one from each other, having board cutting edges of their crowns: the second and the third incisors were larger having double cutting edges. On the lower jaw the incisors were larger but narrow, lanceolate with sharp edges being directed horizontally and forward. Their tips fit within the upper arcade and press against a pad on the front of the palate. The mandible symphysis was flexible so the lower incisors move one next to each other. The premolars (Dentes premolares) are compressed with small longitudinal edges. The molars (Dentes molares) had quadrate crowns and transversal ridges. All teeth had close roots. The soft palate was smooth. The slender long esophagus (Oesophagus) presented longitudinal folds on its internal surface. Its opening on the stomach marked the cardia orifice (Ostium cardiacum). The stomach (Ventriculi) was the most voluminous component of the digestive tract presents two distinct regions: anterior-fore stomach and posterior-hind stomach

Fig. 1 Oral cavity in kangaroo. 1-three sets of upper incisors; 2-upper premolar; 3-upper molars; 4-lower molar; 5- lower premolars; 6-sharp lanceolate lower incisors;

7-palatinal crests; 8-tongue with visible lingual papille; 9-median visible tongue groove.


176

and due to the presence of three longitudinal muscular bands (Taeniae) it had a colon like appearance. Semi lunar folds between the the taeniae form the haustrations. The well developed fore stomach, was divided into a small sacciform segment, which appeared like a blind sac situated oral from the esophagus opening and a tubular segment-between the gastroesophageal junction and the posterior segment-hindstomach. The separation of the fore stomach in sacciform and tubiform segment was made by a perpendicular plane running from a permanent ventral fold, adjacent to the cardia orifice, to the dorsal wall. The tubiform stomach was delimited from the hind stomach by a shallow fissure. It was composed by the proper region and a small muscular pyloric channel (Canalis pyloricus) which ends at the pylorus orifice (Ostium piloricum). The inner surface of the stomach presented a visible groove (the gastric sulcus) that runs along the lesser curvature of the tubiform stomach. External, the region corresponding to the the pyloric antrum (Antrum piloricum) was well visualized due to its muscular pattern with a clear demarcation from the duodenal orifice. The duodenum was long, lacking an obvious ampulla. Jejunum was long too, with numerous convolutions sustained by a large mesentery, but the ileon was short. The ileo-

Fig. 2 Topography of postdiaphragmatic digestive organs in kangaroo. SFS-saciform forestomach; TFS-tubiform forestomach; HS-hindstomach; L-liver; GB-

gallbladder; AC-ascendant colon; TC-transverse colon; J-jejunum; H-heart; P-right pulmonary lobe


177

ceco-colic (Ostium cecocolicum) junction was well visualized. The cecum was small, elongated with no muscular bands and sacculations (Haustra ceci) and laks appendix. The colon was short, without haustra (Haustra coli) but presented a large mesocolon and a sigmoidian dilatation (Colon sigmoideum) on its end. There was a

clear division of the colon in ascendant (Colon ascendens), transverse (Colon transversum) and descendent ansa (Colon descendens). The ascendant ansa had three turns on the right side, runs to the left side as transvers colon than in caudal direction up to the rectum as descendant colon.

In all mammal species, morphology of the digestive systems is the response of mechanical and chemical characteristics of the specific diets, being the main system involved in maintaining the balance between the food and the demand for energy necessary for vital processes, nursery and reproduction (2,3,13,14). Herbivorous species are the most widespread mammals and are found in 11 orders

Fig. 3. Components of postdiaphragmatic digestive system of kangaroo. Note the voluminous tubular stomach “colon” like appearance, with two forestomach components:SFS-saciform forestomach and TFS-tubiform forestomach; HS-hind stomach; Py-pylorus; D-duodenum; J-jejunum; Il-ileum; M-mesentery; C-

long, tubular cecum without haustra and muscular bands ; AC-ascendant colon; TC-transverse colon; DC-descendant colon, all colon segments smooth

with no haustra and taenia; Sd-sigmoid dilatation; R-rectum


178

showing the widest ecological distribution. But, the significant differences between the herbivores lie in the relative amounts of nutrients and the manner in which they harvesting, extracting and processing their requirements (2,3,9). In herbivores the first adaptation of the digestive system of the nutritive requirements was the development of an extremely efficient masticatory apparatus (9,11). Although some species have either lost or adapted some teeth for other purposes, dentition of the most mammals include incisors teeth for cutting, canines for tearing, premolars and molars for mastication and crushing. The distinctive feature of the macropodide skull is the presence of the dental particular feature. The presence of the three sets of superior blade-like incisors arranged in a U shape arcade is specific for macropodidae and it was found by us too, in examined subjects. Also, the two procumbent lower incisors was the largest teeth lying as a pair of blades edge to edge, their tips fit within the upper incisor arcade and press against a pad on the front of the palate was observed in examined subjects. This feature is found in some lagomorphs but is in contrast with the other diprotodont mammals in which the lower and upper incisores occlude at least in part. The diprotodonty is found in the lower arcade and is represented by the shading of the lower incisors, which are replaced by the premolars and the molar teeth which migrate forward (9). The molars erupt sequentially at the back of the each jaw their position being modified through elongation of the growing and through forward migration when the front teeth are worn (9). In the present study we noted the presence of all teeth in both subjects due to the young age of subjects. The replacement of worn teeth is an adaptation of the abrasive diet and is unique among methaterians (marsupials) mammals, but is found in some eutherians (placentals) mammals – such as elephants. The next segment of digestive system, the esophagus was relative long in the examined subjects and the internal mucosal layer shows longitudinal folds. Esophagus opening marked the cardia orifice and externally was the delineation between the two segments of forestomach: the saciform and tubular segment. This is similar with the cardia orifice of ruminants which is located on the cranial dorsal sac of the rumen at the level of ruminal atrium. Also, the presence of the gastric sulcus which runs along the lesser curvature of the tubiform stomach is similar with the groove (esophageal gutter) found in ruminants, especially in young ruminants.

Most herbivores obtain a substantial part of their nutrients by the retention and microbial fermentation of plant material into the specific sites of the digestive system –voluminous stomach, cecum or large colon (1,2). Yet, no vertebrate animal is known to produce a cellulose enzyme capable of cellulose digesting process. In this condition microbial fermentation is the key of the digestion in all herbivores (14,15). It is stated that the marsupials and ruminants share the same type of digestion-foregut fermentation in order to increase fiber digestibility and increase nutrient absorption even of an apparent independent evolution of this species. The microbial fermentation take place in both, marsupials and ruminants in an enlarged forestomach, proximal to their acid secreting hind stomach or small intestine (6,7,14,15). However, major differences exist in digestive system morphology


179

between the two species. The basic digestive anatomy of ruminant species is the four chambered stomach - reticulum, rumen omasum and abomasums. The rumen and reticulum acts as the main site of fermentation while the omasum serve as the transfer organ from the first two compartments into the secretory segment – abomasum. Our results show that in kangaroo, there is no such a division of the stomach, from the gastroesophagian orifice to the duodenal entry a single compartment was present. Compare to the monogastric species the major differences of kangaroo stomach was the presence of the external taenie and corresponding haustrations formed by the specific arrangement of the longitudinal and circular muscular bands which gave the stomach “colon” like appearance or like cecum in hindgut fermenters (12). Also, the external conformation shows two segments – anterior or fore stomach and posterior or hind stomach. This observation is in agreement with Stevens and Hume (1995) who showed that the forestomach of marsupials is responsible for fermentation of ingested food and the hind stomach is the secretory compartment. This secretory compartment by its HCl and pepsinogen secretion is the correspondent of the abomasum in ruminants and to the typical stomach of monogastric species. Moreover, based on morphological observation and similar to the results of Hume, (1999) the forestomach could be divided into a sacciform segment and tubiform segment. The sacciform segment is the site of microbial fermentation and the tubiform segment has a storage function like the omasum in ruminants. Morphological development of fermentation chambers is direct related to the digestive strategy and herbivores have evolved specialized gut compartments to maintain the ingesta as long time is needed for efficient fermentation of fibrous plant (2,6,13,14,15). There are two type of fermentation according to the where fermentation take place into digestive tract: anterior to the acid secretory stomach, defined as foregut fermenters (ruminants and marsupials) and posterior to the stomach, the hindgut fermenters-in which the cecum or colon is the main site of fermentation (lagomorphs, rodents, equines). Even the same objective is required: the cellulose digestion of indigestibile plants celular wall via microbial fermentation, there are major differences both in morphology and physiology of the species digestive systems. Morphologically the foregut fermenters have well developed stomach while the hindgut fermenters have enlarged cecum or colon. This anatomical feature offered foregut fermentation numerous advantages over hindgut fermentation. Fermentation occurs in the enlarged cardial region of the stomach of foregut fermenters and enzymatic digestion from small intestine is facilitated by the prior fermentation and the microbial cells are able to be utilized in digestion in the small intestine but in hindgut fermentation, these cells are lost in the feces. To compensate and regained the lost nutrients, the hindgut fermenters practice coprophagy (8,10,12,16).

Even we historically compared the kangaroo forestomach with the rumen reticulum of foregut-fermenting ungulates, in form and function, the tubiform forestomach of kangaroos is more like the hindgut of the colon-fermenting horse. This comparison is in agreement with Stevens and Hume (1995) and Hume (1999).


180

As we show the kangaroo forestomach is characterized by numerous haustrations that likely provide elastic support for physical flexibility in content loads, probably facilitating reserve gut capacity under different nutritional circumstances. Regarding the small intestine, our results pointed out the relative length of the small intestine and the shortness of the colon and are similar with the reports of Munn (2010) (6,7). The presence of a small cecum in examined subjects is in concordance with other reports but the cecal appendix was not visualized. Cecal morphology is similar to that of ruminants due to the absence of sacullations, muscular bands and cecal appendix, but relative to the size, we consider the cecum in kangaroo is less developed compared to the digestive volume and compare to ruminants. Even the two distinct segments were visualized, one basal and one apical, the apical segment of the cecum could not be defined as cecal appendix because there is no profound change in diameter marking the junction between the two segments mentioned above, like is found in rabbits (12,16). Compare to hindgut fermenters in which the colon present muscular bands and numerous haustra it was obvious the lack of colon haustra in our subjects. This feature is a morphological adaptation related to the foregut digestion being a direct consequence of the major development of the stomach in marsupials. However, digestive plasticity of midgut and hindgut was reported in a numerous species including rabbit, vole-rat or even lactating domestic cattle (5), phenotypic gut plasticity being related with the fiber content of forage and ingesta particle size.

Conclusions

The most important feature of the digestive system of kangaroo is the presence of a large haustrated stomach with two segments: forestomach and hindstomach. The forestomach is divided into the saciform region- the site of microbial fermentation and tubiform region, with storage function.

Diprotodont type of dentition of kangaroo is the result of development of an efficient masticatory apparatus as a response of abrasive diet.

The cecum is a small, tubular organ lacking an appendix.The small intestine and colon are considerable shorter than in ruminants and the colon show no haustra.

Even if the digestive strategy of foregut fermentation of marsupials is similar with that of ruminants in order to increase fiber digestibility and increase nutrient absorption, there are many major differences between the digestive morphology between the two groups which were revealed in this study.


181

References

1. Franz, R., Kreuzer, M., Hummel, J., Hatt, J-M., Clauss, M., Intake, selection, digesta retention, digestion and gut fill of two coprophageous species, rabbits (Oryctolagus cuniculus) and guinea pigs (Cavia porcellus), on a hay-only diet, Journal of Animal Physiology and Animal Nutrition, 2011, 95, 564–570.

2. Hackmann, T.J., Spain, J.N., Ruminant ecology and evolution: perspectives useful to ruminant livestock research and production. Journal of Dairy Science, 2010, 93: 1320–1334.

3. Hume, I. D. Digestive Physiology and Nutrition of Marsupials. New York: Cambridge Univ. Press, 1982.

4. Hume, I.D., Marsupial Nutrition. Cambridge University Press, Cambridge, 256, 1999.

5. Munn, A.J., Clissold, F., Tarszisz, E., Kimpton, K., Dickman, C.R., Hume, I.D., Hindgut plasticity in wallabies fed hay either unchopped or ground and pelleted: fiber is not the only factor. Physiol Biochem Zool, 2009, 82, 270–279.

6. Munn, A. J., Dawson, T. J., & McLeod, S. R., Feeding biology of two

functionally different foregut‐fermenting mammals, the marsupial red kangaroo and the ruminant sheep: how physiological ecology can inform land management. Journal of Zoology, 2010, 282(4), 226-237.

7. Munn, A. J., Streich, W. J., Hummel, J., Clauss, M., Modelling digestive constraints in non-ruminant and ruminant foregut-fermenting mammals. Comparative biochemistry and physiology. Part A, Molecular & integrative physiology, 2008, 151(1), 78.

8. Sakaguchi, E., Digestive strategies of small hindgut fermenters. Anim Sci J, 2003, 74, 327–337.

9. Sanson, G. D., McArthur, C., Tooth wear in eastern grey kangaroos (Macropus giganteus) and western grey kangaroos (Macropus fuliginosus), and its potential influence on diet selection, digestion and population parameters. Journal of Zoology, 1988, 215, 491–504.

10. Stan, F., Comparative study of the stomach morphology in rabbit and chinchilla. AgroLife Scientific Journal, 2013, Vol. 2(2), 73-78.

11. Stan, F., Comparative morphological study of oral cavity in rabbits and guinea pigs, Scientific Works. Series C. Veterinary Medicine, 2014, Vol. LX (1), 27-32.

12. Stan, F., Anatomical particularities of the cecum in rabbits and chinchillas, Bulletin UASVM Veterinary Medicine, 2014, 71(2), 406-412.

13. Steuer, P., Südekum, K.H., Müller, D.W.H., Franz, R., Kaandorp, J., et al. Is there an influence of body mass on digesta mean retention time in herbivores? A comparative study on ungulates. Comparative Biochemistry and Physiology, 2011, 160, 355–364.


182

14. Stevens, C.E., Hume, I.D.,. Comparative Physiology of the Vertebrate Digestive System. 2nd ed. Cambridge University Press, Cambridge,1995.

15. Stevens, C.E., Hume, I.D., Contributions of microbes in vertebrate gastrointestinal tract to production and conservation of nutrients. Physiological Reviews 1998, 78, 393–427.

16. Udén, P., Van Soest, P.J., Comparative digestion of timothy fiber by ruminants, equines and rabbits. British Journal of Nutrition 1982, 47, 267–272.


183

DEEP PECTORAL MYOPATHY (GREEN MUSCLE DISEASE) IN A HOUSEHOLD REARED AND SLAUGHTERED BROILER

CHICKEN – A CASE STUDY

A. STANCU, I. OLARIU-JURCA, A. OLARIU-JURCA, CLAUDIA SALA, ADRIANA MORAR, M. PENTEA, K. IMRE

Banat‟s University of Agricultural Sciences and Veterinary Medicine ”King Michael I of Romania” from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului

Street No. 119, Timisoara, Romania E-mail: [email protected]

Summary

Deep pectoral myopathy is considered a degenerative disease and a great

challenge for the broiler meat industry. The disease appears as a surprise before preparation because of the unplasent aspect. This get a lot of consumer complains. Even if the consumer safety is not jeopardized the raw meat is organoleptic compromised and unfit for consumption. The paper describe a case of deep pectoral myopathy in a broiler chicken reared in backyard condition in order to offer important information in the disease recognition, especially for the public consumer. Visual inspection carried out of the sectioned breast level revealed bilateral macroscopic modifications consist of a well delimited greenish color of the breast muscle with slightly friable consistency, crumbly and dry look. The disease diagnostic was established on the basis of the presence of characteristic color changes (green) at the muscle level. In addition, histopathological examination showed characteristic lesions including necrotic and hyalinisated muscle fibers with discoid degeneration and frontier mesenchymal reaction. Data presented in the current case study are of public interest, with important contributions to the knowledge of consumer about this “hidden disease”.

Key words: miopaty, pectoral, grouse, friable Deep pectoral myopathy (DPM, commonly referred to as„ green muscle

disease”) is considered a degenerative disease, a hidden problem and a great challenge of the broiler meat industry (3, 9, 11, 12). It is appearing to the consequence of the deficient of oxygen associated with wing flapping and affects the most valuable part of the carcass (breast) (4, 6, 11, 12). Usually, the disease is detected during the deboning of the bird carcass (3, 11, 12).

On pathologic examination meet different aspects depending on the stage of disease evolution.

In acute forms, entire supracoracoid muscle looks edematiated and is covered by a fibrinosa membrane, sometimes with presence of hemorrhages.


184

Necrotic tissue is white or pink, and outer edges have a a greenish color. These lesions are limited usually at the middle portion of supracoracoid muscles.

In the chronic form, the examination pectoral muscles, the section is observed dry appearance and greenish coloration. Consistency is friable at palpation.

The pathophysiological mechanism of the disease can be explained by the fact that the affected skeletal muscle fibers suffer a shortage of oxygen and is associated with accelerated movements of the wings. Although many muscles contract only supracoracoid muscle is affected. During muscle contraction, blood flow increases significantly to ensure pluses of oxygen and nutrients needed.

Deep myopathy changes in three phases: (a) initially meet acute inflammatory lesions of minor pectoral muscle, it

gets a shade reddish hemorrhagic; (b) phase in which lesion of inner pectoral muscle is more clearly defined

and is, in some cases, surrounded by a hemorrhagic ring; (c) phase in which the progressive degeneration of fiber pectoral muscle of

inner muscle with the necrosis greenish color. When the poultry meat is marketed as whole carcass or parts, in the

household kitchen of the consumer, the lesions appear as a surprise before preparing and frequently resulting with in consumer complaints. Even if the disease has no public health significance, the appearance of the meat is affected and makes it repulsive to eat (3, 4, 9, 11, 12). In the current paper we report a case of deep pectoral myopathy in a broiler chicken reared in a household backyard, in order to offer useful information to consumers, veterinarians and public health specialists.


In March 2013, one poultry owners from rural area of Timis County brought the Department of Food Safety and Veterinary Public Health, of the Faculty of Veterinary Medicine Timişoara a broiler chicken meat in a private household who killed eight chickens aged eight weeks.

Macroscopic inspection of meat were identified injuries to muscles supracoracoid. It was observed greenish-yellow color, dry appearance and friable consistency.

Microscopically was observed inflammations and necrosis on the surfaces extended hyalinosis and discoid degeneration. Also adjacent areas of lesions was observant a mesenchymal reaction after replacing. Necrotic tissue was also present.

The macroscopic and microscopic aspects observed suggest shape the existing of chronic epicutaneous application of the disease.

For the microscopic examination the samples preparation was carried out as follows: 24 hours alcohol fixation at room temperature (prevent the tissue


185

alteration due to the enzymes activity; preserve the tissue texture; improves the optical differentiation), alcohol dehydration (five steps: 70%; 80%; 90%, 100% and 100% alcohol, each step for two hours), clearing with benzene, paraffin wax at 56°C, embedding tissues into paraffin blocks, trimming of paraffin blocks (6 µm), sections mounting on the glass slides (using Meyer albumin), hematoxylin - eosin - methylene blue staining (12).

Staining was performed as follows: deparaffination of tissue sections in benzene, rehydration using decreasing concentrations of alcohol, rinsing in distilled water, hematoxylin staining, alcohol, eosin staining and methylene blue staining, water removal using increasing concentrations of alcohol, cover slide mounting (12). Hematoxylin will stain the nuclei in blue and the mucins in light blue. Eosin will stain the cytoplasm in pink, collagen in pale pink, red blood cells in bright red, and colored in red. Methylene blue improves the blue color of the nuclei, making them more observable (12).

Diagnosis was established on the basis of examination of gross muscular tightened, this changes the color characteristic. They have been harvested samples with a view to the completion of the macroscopic examination histopathological examination.


At macroscopic examination of muscular tightened deep represented by Supracoracuideus muscle showed a distinct change of color, namely normal color front muscular, in depth it was noted bilaterally agreed, areas that are well delimited by color consistency slightly greenish and friable, crumbly and looks dry. (Figure 1, Figure 2).

Fig.1 Muscle necrosis.

Apparenlly unaffected chicken Fig. 2 Muscle necrosis.

Deep pectoral myopathy


186

The histopathological examination (Hematoxylin-eosin stain, methylene blue stain, 20x) histopathology is observed necrosis and discoid degeneration of muscle fibers. It is found also hyalinisation areas with peripheral mesenchymal reaction.

Fig. 3. Deep pectoral miopathy

(Hematoxylin-eosin-methylene blue staining, 20x)

Muscle fibers necrotic

Fig. 4. Deep pectoral miopaty. (Hematoxylin-eosin-methylene blue

staining, 20x) Muscle fibers hialinisated with frontier

mezenchimal reaction

During the carcass inspection or sorting the detection of Deep pectoral myopathy is very difficult. In most cases, the disease is diagnosed during the deboning process or as “kitchen surprise”, when the consumer purchase the whole carcasse and the deboning operatin before cooking is carried out in household conditions. Even if the consumer safety is not jeopardized the raw meat is sensory impaired and unfit for consumption.

Conclusions

Data presented in the current report offer important information for

consumers and veterinary practitioners. Deep chest miopatia was not preceded by clinical signs of disease, being

observed as a surprise at the exam necropsic. Supraliminal muscular efforts under stress have led to edematiated

muscles, which favored vascular stasis and was the main cause of this disease. The macro- and microscopic exam confirmed diagnosis of the disease.


187

References

1. Bianchi, M.M., Petracci, A., Franchini, A. Cavani, C., The occurrence of deep pectoral myopathy in roaster chickens. Poult. Sci., 2006, 85, 1843 – 1846.

2. Coțofan, Otilia, Diagnostic necropsie, Lito. I.A.T. Iaşi, 1986. 3. Jubb, K. V. F., Keenedz, P. C., Palmer, N., - Pathology of domestic

Animals, vol. 1, 2, 3, Ed. Academic Press, San Diego, California, U.S.A, 1993.

4. Lien, R.J., Bilgily, J.B., Hess, J.B., Joiner, K.S., Induction of deep muscle myopathy in broiler chickens via encouraged wing flapping. J. Appl. Poult. Sci., 2012, 21, 556 - 562.

5. Mcgavin, M.D., Cartlon, W.W., Zachary, J.F., Special Veterinary Pathology, Ed. Mosby, Inc, Missouri, U.S.A, 2001.

6. Oprean, Z., O., Morfopatologie generală veterinară, Ed. Ion Ionescu de la Brad", Iaşi, 1998.

7. Page, R.K., Fletcher, O.J. - Myopathy of the deep pectoral muscle in broiler breeder hens. Avian. Dis., 1975, 19, 814 – 821.

8. Paul, I., Etiomorfopatologie veterinară, vol. 3, Ed. .Ion Ionescu de 1a Brad", Iaşi, 2001.

9. Richardson, J.A., Burgener, J., Winterfield, R.W., Dhillon, A.S. Deep pectoral myopathy in seven-week-old broiler chickens. Avian. Dis. 1980, 24, 1054 – 1059.

10. Şincai, Mariana., Tehnici de citohistologie normală şi patologică. Ghid practic, Ed. Mirton, Timişoara, 2000.

11. http,//en.aviagen.com/assets/Tech_Center/AA_Technical_Articles/AAUpdateGreenMuscle.pdf.

12. http,//www.thepoultrysite.com/articles/3142/deep-pectoral-myopathy-green-muscle-disease-in-broilers.

http://en.aviagen.com/assets/Tech_Center/AA_Technical_Articles/AAUpdateGreenMuscle.pdf

http://en.aviagen.com/assets/Tech_Center/AA_Technical_Articles/AAUpdateGreenMuscle.pdf

http://www.thepoultrysite.com/articles/3142/deep-pectoral-myopathy-green-muscle-disease-in-broilers

http://www.thepoultrysite.com/articles/3142/deep-pectoral-myopathy-green-muscle-disease-in-broilers


188

THE ROLE OF LYMPH NODES PATHOLOGICAL LESIONS IN ASSESSING THE EVOLUTION OF RESPIRATORY PRRS

SYNDROME

A. STANCU, I. OLARIU-JURCA, A. OLARIU-JURCA, M. PENTEA, L. FLUERASU

Banat‟s University of Agricultural Sciences and Veterinary Medicine ”King Michael I

of Romania” from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului Street No. 119, Timisoara, Romania E-mail: [email protected]

Summary

Pig reproductive and respiratory syndrome (Porcine Reproductive and Respiratory

Syndrome - PRRS) is a disease infectious with viral etiology, characterized by symptoms and lesions localized to the respiratory and genital tract. After the official reporting in the U.S. in 1987 the disease quickly spread being reported in Germany and the Netherlands and subsequently in many countries.

In 1998, the disease was officially diagnosed in Romania, currently having widespread in intensive swine both sows and the young after weaning, causing significant economic losses.

The research covered in this paper was performed in order to elucidate the pathological lesions found in young swine after weaning in respiratory location.

Key words: PRRS, lymph nodes, pigs

PRRS is caused by a virus which was first isolated and classified as an

arterivirus as recently as 1991. The virus of PRRS has a particular affinity for the lung. It is know that when grower/finisher unit become infected with PRRS virus the disease evaluate as enzootic pneumonia (1, 2, 3, 6, 7, 8, 9).

The research covered in this paper were performed in order to elucidate the pathological lesions found in young swine after weaning in respiratory location.


Necropsy was conducted on the bodies of young swine after weaning, in

many intensive pig farms of Smithfield Company. On the necropsied corpses macroscopic lesions were noted existing on the inguinal lymph nodes and samples were collected for the pathological examination. For histological evidence of lesions samples were fixed in formalin, embedded in paraffin, and sections were stained by the method of HEA (hematoxylin-eosin-methylene blue).


189


There were a total of 115 corpses necropsied pigs aged 2-4 months. On 26 (22.6%) bodies were observed lesions in the lymph nodes were samples for histopathological examination.

On macroscopic examination has been observed lesions at the level of more than one category of lymph nodes: mandibular, retropharyngeal, tracheobronchial, iliac, mediastinal lymph nodes, ingvinal. They have been increased in weight and volume of 2-5 times, color pale or bloodshot to cut, when it has been found that a moist because of serous exudates. (Figure 1, Figure 2) Such injuries have been highlighted and other authors as well as: Dea et al. 1992, Halbur et al 1995., Rossov et al 1994 (5,6).

For the purpose of carrying out histological examination were sampled ingvinal lymph nodes. It was observed hypertrophy germinal center and hiperplasia, necrotic germinal center where they have been observed and areas of infectious. In use-dependent cortical reorganization have been highlight cyst of small business.

Microscopic lesions are varied from the point of view of timing and severly. They were noted with regard to lymphoid follicles reagents as a result of migrating lymphocytes as well as with the center area in the periphery (lymphocyte depleted). (Figure 5, Figure 6). Similar lesions have been described by Rossow et al. 1994, which has shown many small cyst in use-dependent cortical reorganization (5,6).

These morphological aspects micro and macroscopic are correlated with phase of the onset of the disease, when are not involved other bacterial infection.

In these study reveal important observations at microscopic examination of ingvinal lymph nodes, there was a reddish at on the surface and section, characteristic by congestion and hemorrhage (Figure 3, Figure 4).

Fig.1. Ingvinal lymph nodes. Macroscopic

presentation in the early stages of the disease

Serous lymphoreticulitis

Fig.2. Ingvinal lymph nodes. Macroscopic presentation on section in stages of the

disease Serous lymphoreticulitis


190

Fig. 3. Ingvinal lymph nodes. Macroscopic

presentation in the advanced stages of the disease

Diffuse hemorrhagic lymphoreticulitis

Fig. 4. Ingvinal lymph nodes. Macroscopic presentation on section in

the advanced stages of the disease Diffuse hemorrhagic lymphoreticulitis

Fig.5. Ingvinal lymph nodes Fig.6. Ingvinal lymph nodes

Microscopic presentation germinal center necrosis with lymphocyte depletion Hematoxylin-eosin-methylene blue staining,

10x, 20x

On microscopic examination confirmed circulatory disorders (congestion and hemorrhage), and showed areas of necrosis. (Figure 7, Figure 8). These latter aspects show that it for congestive phase and can be correlated with septicemic form resulting from secondary bacterial infections. Of the 26 (65.38%) bodies that were observed lesions in the lymph nodes in 17 (34.62%) cases was observed hemorrhagic lymphoreticulitis and 9 cases serous lymphoreticulitis.


191

Fig. 7. Ingvinal lymph nodes. Diffuse

hemorrhagic lymphoreticulitis. Fig 8. Ingvinal lymph nodes. Diffuse

hemorrhagic lymphoreticulitis. Microscopic presentation multiple congestion and hemorrhage of vessels in the

lymph nodes. Hematoxylin-eosin-methylene blue staining,10x, 20x

Conclusions

Macroscopic examination has revealed lesions at the lymph nodes level: mandibular, retropharyngeal, tracheobronchial, iliac, mediastinal, ingvinal.

Microscopic examination revealed non-specific aspects but especially being similar to the specific data from literature.

Secondary bacterial infections type panel septicemic complicating lesional lymph nodes met at the level.

References

1. Halbur, P.G., Paul, P.S., Frey, M. L., Landgraf, J., Eernisse, K., Meng,

X. J., Lum, M. A., Andrews, J. J., Rathje, J. A. Comparison of the Pathogenicity of Two US Porcine Reproductive and Respiratory Syndrome Virus Isolates with that of the Lelystad Virus, Vet Pathol, 1995, 32, 648-660.

2. Perianu, T. Tratat de Boli Infecțioase ale Animalelor, (sub redacția), vol. II, Viroze și boli prionice, Ed. Universitas XXI, Iași, 2012.

3. Rossow, K. D., Collins, J. E., Goyal, S.M., Nelson, E.A., Christopher-Hennings J., Benfield D.A. Pathogenesis of Porcine Reproductive and Respiratory Syndrome Virus Infection in Gnotobiotic Pigs, Vet Pathol, 1995, 32, 36 1-373.

4. Rossow, K.D., Laube, K. L., Goyal, S. M., Collins, J. E. Fetal Microscopic Lesions in Porcine Reproductive and Respiratory Syndrome Virus-induced Abortion, Vet Pathol, 1996, 33, 95-99

5. Rossow, K. D., Benfield, D. A., Goyal, S. M., Nelson, E.A., Christopher-Hennings, J., Collins, J. E., Chronological Immunohistochemical


192

Detection and Localization of Porcine Reproductive and Respiratory Syndrome Virus in Gnotobiotic Pigs, Vet Pathol, 1996, 33, 551-556.

6. Rotaru, Elena Sindromul tulburărilor respiratorii şi de reproducţie al porcilor, În, Boli Virotice şi prionice ale animalelor, Sub redacţia, RADU MOGA MÂNZAT, Ed. Brumar, Timişoara, p. 245-261, 2005.

7. Stancu, A., Olariu-Jurca, I., Olariu-Jurca, A., Fluerașu, L. D. Observations on pathological lesions in young swine PRRS syndrome after weaning, Lucr. Șt. Med. Vet., 2014, Vol. XLVII [1], Timișoara.

8. Stănuică, D. Sindromul de Reproducţie şi Respirator Porcin, Lucrare realizată în cadrul Proiectului „Sprijinirea Serviciilor din Agricultură”, 2005.

9. Zimmerman, J. J., Benfield, D. A., Scott, A. D., Murtaugh, M. P. Stadejek, T., Stevenson, W. G., Torremorell M. Porcine reproductive and respiratory syndrome virus (Porcine arterivirus) in Disease of swine edited by Zimmerman J.J. 10 th edition, Wiley-Blackwell, 2012.


193

ASSESSMENT OF DAIRY COW WELFARE USING AS CRITERION THE MAN-ANIMAL RELATIONSHIP

I. ŢIBRU, C. LĂZĂRESCU, ELENA CAUC

Banat‟s University of Agricultural Science and Veterinary Medicine Timisoara “King Michael of Romania”, Faculty of Veterinary Medicine, 300645, Calea Aradului, no

119, Timisoara, Romania; E-mail: [email protected]

Summary

The welfare of dairy cows was assessed for 106 cows from three farms: A (38), B (21) and C (47). In all the three farms cows were kept in loose housing and milking was done in the milking hall. WQ evaluation system was used and found that cows that did not allow approaching and touching were 37% in farm A, 38% B and 11% in farm C. And those that did not allow the approaching to less than 1m were 37% in farm A, 24% in farm B and 66% in farm C. These differences can be explained by the fact that in farms A and B housing lots were almost equal to the number of cows compared to farm C where the populating degree was only halfway.

Animal welfare is a controversial and yet not completely defined issue. One of the definitions refers to the effort the animal puts into dealing with the environmental conditions, within the group it is part of, maintaining the reproductive functions and the productive potential. One of the used criteria in assessing welfare is the relation between man-animal, studied in this paper.

Key words: welfare cow, human-animal relationship

Animal welfare is an important attribute of an overall „food quality concept‟

and consumers expect their animal-related products, especially food, to be produced with respect for the welfare of the animals. Recent surveys carried out by the European Commission as well as studies within the Welfare Quality® project, confirm that animal welfare is an issue of considerable significance for European consumers and that European citizens show a strong commitment to animal welfare. In order to accommodate societal concerns about the welfare quality of animal food products as well as related market demands, e.g. welfare as a constituent aspect of product quality, there is a pressing need for reliable science based systems for assessing the animals‟ welfare status.


The following measure was applied to all dairy cows (lactating and dry) and to pregnant heifers if kept with lactating animals. The test started, when at least 75 % of the cows were back in the barn after milking.


194

The examiner placed himself on the feed bunk at a distance of 2 m in front of the animal to be tested. The head of the animal was completely past the feeding rack / neck rail over the feed. We made sure that the animal was attentive or taking notice of our presence. If an animal was not obviously attentive, but also not clearly distracted, it could be tested. A way to attract the animals‟ attention was to make some movements in front of them (at the starting position). If there was not the required distance of 2 m in front of the animals for approaching them, then an angle of up to 45° with the feeding rack was chosen, starting at a distance of 2.5 m. If a distance of 2.5 meters was not possible, the assessment was still carried out but the maximum distance possible was noted down on the recording sheet.

The animal was approached at a speed of one step per second and a step length of approximately 60 cm with the arm held overhand in an angle of approximately 45° from the body. When approaching, the back of the hand was directed towards the animal. We did not look into the animal‟s eyes but at the muzzle. We continued walking towards the animal until signs of withdrawal or until touching the nose/muzzle.

Withdrawal can be defined as the moving back of the animal, turning its head to the side, or pulling back the head trying to get out of the feeding rack; head shaking can also be found.

In the case of withdrawal we estimated the avoidance distance (= distance between the hand and the muzzle at the moment of withdrawal) with a resolution of 10 cm (200 cm to 10 cm possible). If withdrawal took place at a distance lower than 10 cm, the test result was still 10 cm. If the nose muzzle could be touched, an avoidance distance of 0 cm was recorded.

We made sure that the hand was always closest to the animal during the approach (not the knee of the feet). Especially when getting close to animals that were feeding or had their heads in a low position, we bent a little in order to try to touch them.

Neighboring animals that reacted to an animal being tested were tested later on. In order to reduce the risk of influencing the neighbor‟s test result, we chose every second animal. When the reaction was unclear, we retested the animals at a later time.

Individual level: Distance in cm (200-0 cm, with a resolution of 10 cm) Four categories of animals were distinguished and the % of animals in

each of them was combined in a weighted sum, with the following weights: • 0 for animals that could be touched (Avoidance Distance (AD) = 0), • 3 for animals that could be approached closer than 50 cm but not touched

(0 < AD _ 50), • 11 for animals that could be approached as closely as 100 cm to 50 cm

(50 < AD _ 100), • 26 for animals that could not be approached as closely as 100 cm (AD >

100).


195

This sum was computed into an index that varies from 0 (worst situation) to 100 (best situation):

Index for good human-animal relationship I = 100 – 3 (% cat 2) + 11 (% cat 3) + 26 (cat. 4)/ 26

A spline function was used to compute the index into a score (table 1), with the general formula:

Score = a + b x I + c x I2 + d x I

3

with a, b, c, d differing when I is lower or equal to a specific value (called knot) vs. equal or higher that this value.

Table 1

The values for a, b, c, d and the kn Kn 70

a when I < kn 0

a when I > kn - 247.7002454443

b when I < kn 0.7221171736

b when I > kn 11.3378420026

c when I < kn - 0.0103159596

c when I > kn - 0.1619691718

d when I < kn 0.0001114496

d when I > kn 0.0008336078


Farm A with 50 cattle of which 75% were examined:

13 cattle allowed touching;

8 cattle allowed approaching to less than 50 cm, but did not allow touching;

3 cattle allowed approaching between 100 and 50 cm;

14 cattle did not allow approaching to less than 100 cm. Farm B with 58 cattle of which 75% were examined:


10 cattle allowed approaching to less than 50 cm, but did not allow touching;


10 cattle did not allow approaching to less than 100 cm. Farm C with 47 cattle of which 75% were examined:


4 cattle allowed approaching to less than 50 cm but did not allow touching;


31 cattle did not allow approaching to less than 100 cm. In farm A cattle that allowed touching represent 26%, in farm B 36% and in

farm C 10.63%. The difference between the animals that allowed touching for each farm is due to the maintenance system and milking procedure.


196

Farm C had few animals that allowed touching because the maintenance system is more automated than the other two farms.

Conclusions

Cattle that allowed touching in farm A represent 26%, in farm B 36%, and

in farm C 10.63%. Differences are due to technology used. From the man-animal relationship perspective cattle from farm B are the

most used with humans. For the sanitary-veterinary actions (man-animal relationship) is mandatory

to restrict cattle at the feeding rack.

References

1. De Haas, Y., Barkema, H.W., Veerkamp, R.F. The effect of pathogen-specific clinical mastitis on the lactation, 2002.

2. Decun M., Etologia, bunastarea şi protecţia animalelor, Ed.Mirton Timişoara. 2004.

3. Galindo F., Broom D.M., The relationships between social behaviour of dairy cows and the occurrence of lameness in three herds, Research in Veterinary Science, 2000, 69. 75-79.

4. Krohn, C.C., Bihaviour of dairy cows kept in extensive (loose housing pasture) or intensive (the stall) convironments III. Grooming exploration and abnormal behaviour. Applied Animal Behaviour Science, Volume, 1994, 42. 73-86.

5. Von Keyserlingk Marina, Weary D.M., Maternal behavior in cattle, Hormones and behavior, 2007, 52. 106-113.


197

MAINTAINING THE OPTIMUM MICROCLIMATE BY ENSURING THE REQUIRED AIR VOLUME

I. ŢIBRU, C. LĂZĂRESCU, G. SIMION

Banat‟s University of Agricultural Sciences and Veterinary Medicine ”King Michael I of Romania” from Timisoara, Faculty of Veterinary Medicine, 300645, Aradului

Street No. 119, Timisoara, Romania E-mail: [email protected]

Summary

Providing air volume for each animal is a necessity because on this parameter depends the shelter microclimate, health and, implicitly, the animal production. We have studied three farms: farm A with 100 dairy cows, farm B with 2000 swine and farm C with 65,000 laying hens. For a better assessment, everything was expressed as LU (livestock unit) resulting 730. Farm A (100), B (370) and C (260).

In the cow farm, because of the great volume of the housing, location and natural ventilation, there were no problems with providing the necessary air volume.

In the pig farm, it was constantly needed to adjust the sensor and correlate theair flow with the external temperature.

In the poultry farm, in addition to modifying the moment of manure evacuation, it was required the setting, that is the connecting or disconnecting of the fans in order to try to maintain an optimum microclimate.

Key words: effective temperature, cow, pigs, poultry

Domestic animals are relatively adaptable to a wide range of environments

(6, 20, 18, 10, 21). Domestication is a continuing process. Genetic strains of animals selected for growth or reproduction in different environments under varying degrees of control are used currently for much of the production of livestock and poultry (5).

Air temperature, water vapor pressure, and air velocity are some of the most important factors in the physical environment of agricultural animals. In addition, factors related to animal health (i.e., infectious status) and genetics (i.e., transgenic modification) affect the thermal balance of animals and thus their behavior, metabolism, and performance (2, 3, 4).

Actual effective environmental temperature may be temporarily cooler or warmer than the preferred temperature without compromising either the overall well-being or the productive efficiency of the animals (17). Evaluation of thermoregulation or of heat production, dissipation, and storage can serve as an indicator of well-being in relation to thermal environments (12, 9, 16).

The thermal environment that animals actually experience (i.e., effective environmental temperature) represents the combined effects of several variables, including air temperature, vapor pressure, air speed, surrounding surface


198

temperatures, insulative effects of the surroundings, and the age, sex, weight, infectious status, transgenic modification status, adaptation status, activity level, posture, stage of production, body condition, and dietary regimen of the animal.

To overcome shortcomings of using ambient temperature as the only indicator of animal comfort, thermal indices have been developed to better characterize the influence of multiple environmental variables on the animal. The temperature-humidity index (THI), first proposed by Thom (1959), has been extensively applied for moderate to hot conditions, even with recognized limitations related to airspeed and radiation heat loads (16,8). At the present time, the THI has become the de facto standard for classifying thermal environments in many animal studies and selection of management practices during seasons other than winter (13, 17).

Materials and methods Measurements were done in three farms with three different species: birds,

pigs and cows, where it was determined the temperature and air speed by using the Testo device. Measurements were done at the level of each animal respiratory cavities, depending on the species.

Farm cows in which the determinations were done was with loose housing, milking hall and feeding of single feed. Ventilation was of the natural type with a sliding tarp on a wall. Measurements were done along the alley of animal movement, and for lying cows in the rest stall.

Pigs were housed on slatted/grid floors, pit-type hydraulic evacuation, with mechanical ventilation. Air introduction was done by the sidewalls, which were provided with sliding tarpaulin and air evacuation is under the grid. Measurements were carried out in five stalls, which included the whole-house, five determinations being done in each stall.

In birds, which were grown on vertical ecological battery, on seven levels, mechanical ventilation of tunnel type was practiced, with inlets on the sides of the shelter, at one end, and with fans of variable speed at the other end of the shelter. Measurements were done at each level (7) for each row (5) diagonally, to cover an as great area as possible.

The index {wind chill temperature index (°C) = 13.12 + (0.6215 × AT) − [11.37 × (WSPD)0.16] + [0.3965 × AT × (WSPD)0.16]}, where AT = air temperature, °C, and WSPD = wind speed, m/s, is a physiological based model and accounts for inherent errors in the earlier wind chill index (WCI), which was not based on heat transfer properties of body tissues. However, the old WCI closely mimicked heat loss and equivalent temperature equations reported by Ames and Insley (1) for sheep and cattle. Equations developed by Ames and Insley accounted for heat transfer through pelts and hides sections of previously harvested animals; however, they did not account for fat cover and other regulatory processes utilized in mitigating cold stress. In addition, body heat loss due to wind


199

will be proportional to the surface area exposed and not the entire surface area of the body. This error was also inherent in the old WCI.

The THI has further been used as the basis for the Livestock Weather Safety Index (LWSI; 15) to describe categories of heat stress associated with hotweather conditions for livestock exposed to extreme conditions (11,13,14). Categories in the LWSI are alert (74 < THI < 79), danger (79 ≤ THI < 84), and emergency (THI ≥ 84). Additionally, THI between 70 and 74 is an indication to producers that they need to be aware that the potential for heat stress in livestock exists.

After recording the results, calculation was done based on the formula The index {wind chill temperature (° C) = 13.12 + (0.6215 x AT) - [11.37 × (WSPD) 0.16] + [AT 0.3965 × (WSPD) 0.16]}, where AT = air temperature, °C, and WSPD = wind speed, m/s, in order to calculate the effective temperature felt by each animal.


For dairy cows, after calculating the effective temperature it was found

that they are actually higher than those determined by the device, which explains the thermoregulatory capacity of cows at low temperatures.

For fattening pigs, after calculating the effective temperature it was found again that the values sensed by animals are actually higher than those determined by the device, values explaining the need to eliminate excess heat from the shelter.

In hall 1, stall 1, temperature values ranged between 21.3 and 22.3 °C, and the effective temperature oscillated between 26.23 and 26.86 °C.

Table 1 Temperature values in pigs shelters

Stall 1 Stall 2 Stall 3 Stall 4 Stall 5 Stall 6

Hall 1 21.3 -22.3 21.7 -22.4 21.1-21.6 21-21.9 20.9-21.9 22.1 -22.4 26.23-26.86 26.47 –

26.96 26.15 -26.46

26.07 -26.66

26 -26.66 26.8 -26.99

Hall 2 21.6 -22.2 22 -23 21.1 -21.6 21- 21.9 20.9 – 21.9 22.1 – 22.4 26.42-26.79 26.58 -

27.29 26.15 – 26.46

26.07 – 26.66

26 – 26.66 26.8 -26.99

For layer hens after calculating the effective temperature it was found

again that the values sensed by animals are actually higher than those determined by the device, values explaining the need to eliminate excess heat from the shelter, values explaining the need to eliminate excess heat from the shelter.


200

Table 2 Temperature values in hens shelters

Place Level 1 Level 2 Level 3 Level 4 Level 5 Level 6 Level 7

1 21.1 21.2 21.3 21.8 21.5 21.3 21.9 26.03 26.23 26.33 26.64 27.05 27.56 27.94 2 24.6 24.6 25.3 25.9 27 27.5 28 28.28 28.35 28.77 29.16 29.88 30.20 30.51 3 27.6 27.4 27.4 27.5 29.4 29.4 29.8 30.26 30.14 30.14 30.19 31.41 31.40 31.67 4 27.7 27.6 27.7 27.8 28.7 29 29.2 30.32 30.26 30.33 30.39 30.93 31.14 31.27 5 28.6 28.1 28 28.2 28.7 28.9 29.2 30.89 30.57 30.51 30.64 30.95 31.08 31.27 6 24.9 24.6 24.5 24.5 24.7 24.9 25.3 28.53 28.39 28.32 28.33 28.45 28.57 28.82 7 21.7 22 22.4 22.9 23.8 24.4 24.8 26.37 26.73 26.93 27.22 27.80 28.21 28.45 8 26.3 26.4 26.6 27 27.7 28.3 29.3 29.42 29.51 29.60 29.87 30.31 30.70 31.33 9 27.2 27.4 27.5 27.8 28.3 28.7 29.1 30 30.12 30.18 30.37 30.69 30.95 31.21

10 23.4 23.5 23.8 24.5 25.3 25.8 26.3 27.44 27.68 27.80 28.22 28.76 29.11 29.43

11 26 26 26.2 26.8 27.6 28 28.4 29.21 29.25 29.38 29.76 30.26 30.51 30.76

12 25.9 26 26.2 26.5 27.1 27.6 28 29.11 29.25 29.36 29.53 29.94 30.25 30.50

13 24.9 24.8 24.9 25.2 25.5 26 26.4 28.54 28.49 28.56 28.76 28.94 29.26 29.49

14 26.3 26.4 26.7 27.1 27.9 28.4 28.8 29.44 29.52 29.69 29.95 30.45 30.76 31.02

15 28 28 28 28.2 25.5 28.7 29.1 30.51 30.51 30.51 30.64 30.82 30.95 31.20

16 24.2 24.2 24.2 24.4 25.2 25.6 25.7 27.96 28.03 28.10 28.20 28.70 28.29 29.07

17 19.8 19.8 20 20.3 20.9 21.3 21.8 25.34 25.34 25.48 25.69 26.07 26.31 26.64

18 27.9 28.1 28.2 28.3 28.5 28.6 28.7 30.45 30.57 30.64 30.70 30.83 30.89 30.95

19 26.9 26.9 26.9 27.2 27.6 27.9 28.4 29.83 29.82 29.82 30 30.24 30.43 30.76

20 28 27.8 27.6 27.6 27.7 28 28.3 30.51 30.38 30.25 30.25 30.32 30.51 30.70

21 26.6 26.3 26.2 26.2 26.4 26.7 27 29.62 29.42 29.36 29.35 29.49 29.69 29.88

22 20.2 19.8 19.4 19.1 18.5 18.5 18.5 25.49 25.29 24.93 24.57 24.38 24.44 24.18

Conclusions

Always there is a difference between the measured temperature and the effective temperature, felt by the animal.


201

The difference is determined by the species and animal categories, but is influenced by the temperature and air speed from the shelter.

In dairy cows, generally, there are small problems. In pigs and birds, it is important to eliminate excess heat from the shelter.

In birds, as density is greater as temperature differences are higher.

References

1. Adams, A. W., Craig, J. V., Effect of crowding and cage shape on productivity and profitability of caged layers, A survey, Poult., Sci. 1985, 64, 238–242.

2. Algers, B., Jensen, P., Communication during suckling in the domestic pig. Effects of continuous noise. Appl. Anim. Behav. Sci., 1985, 14. 49–61.

3. Algers, B., Jensen, P., Teat stimulation and milk production during early lactation in sows, Effects of continuous noise. Can. J. Anim. Sci., 1991, 71, 51–60.

4. Ames, D. R., Insley, L. W., Wind-chill effect for cattle and sheep. J. Anim. Sci. 40, 161–165. ARS. 2002. ARS Facilities Design Standards. Publication 242.1MARS. 1975, http, //www.afm.ars.usda.gov/ppweb/242-01m.htm.

5. Buhman, M., G. Dewell, Griffin, D., Biosecurity Basics for Cattle Operations and Good Management Practices (GMP) for Controlling Infectious Diseases. University of Nebraska-Lincoln Extension, Institute of Agriculture and Natural Resources. Publication G1411, 2000 http, //www.ianrpubs.unl.edu/epublic/live/ g1411/build/g1411.pdf.

6. Craig, J. V., Domestic Animal Behavior. Prentice-Hall, Inc., Englewood Cliffs, NJ., 1981.

7. Craig, J. V., Genetic influences on behavior associated with well-being and productivity in livestock. Proc. 5th World Congr. Genet. Appl. Livest. Prod., 1994, (2), 150–157.

8. Duncan, I. J. H., Welfare is to do with what animals feel. J. Agric. Environ. Ethics, 1993, 6(Suppl. 2), 8–14.

9. Eigenberg, R. A., Hahn, G. L., Nienaber, J. A., Parkhurst, A. M., Kocher M. F., Tympanic temperature decay constants as indices of thermal environments, swine. Trans. ASAE, 1995, 38, 1203–1206.

10. Fraser, A. F., Broom, D. M., Farm Animal Behaviour and Welfare. Balliere-Tindall, London, UK., 1990.

11. Fraser, D., Assessing animal well-being, common sense, uncommon science. In Food Animal Well-Being, Conference Proceed-HUSBANDRY, HOUSING, AND BIOSECURITY 27 ings and Deliberations. West Lafayette, USDA, and Purdue Univ. Office Agric. Res. Programs, West Lafayette, IN. 1993.


202

12. Hahn, G. L., Chen, Y. R., Nienaber, J. A., Eigenberg, R. A., Parkhurst A. M., Characterizing animal stress through fractal analysis of thermography responses. J. Therm. Biol. 1992, 17, 115–120.

13. Hahn, G. L., Mader, T. L. Eigenberg, R. A., Perspective on development of thermal indices for animal studies and management. Pages 31-44 in Interactions Between Climate and Animal Production. N. Lacetera, U. Bernabucci, H.H. Khalifa, B. Ronshi, and A. Nadone, ed. EAAP Technical Series No. 7. Wageningen Academic Publishers, Wageningen, the Netherlands. 2003.

14. Johnson, A. K., Mitloehner, F. M. Morrow, J. L. McGlone, J. J., Effects of shaded versus unshaded wallows on behavior, performance, and physiology of outdoor lactating sows. J. Anim. Sci., 2008, 86, 3628–3634.

15. Mitlohner, F. M., Morrow-Tesch, J. L., Wilson, S. C., Dailey, J. W. McGlone, J. J., Behavioral and sampling techniques for feedlot cattle. J. Anim. Sci. 2001, 79, 1189–1193.

16. NIH., Biosafety Considerations for Research with Lentiviral Vectors. Recombinant DNA Advisory Committee (RAC) Guidance Document, 2006. http, //www4.od.nih.gov/oba/RAC/Guidance/LentiVirus_Containment/index.htm

17. NRC., Effects of Environment on Nutrient Requirements of Domestic Animals. Natl. Acad. Press, Washington, DC. 1981.

18. Price, E. O., Farm Animal Behavior. Vet. Clin. North Am. Food Anim. Pract. 3. W. B. Saunders Co., Philadelphia, PA. 1987.

19. Rodenburg, T. B., Koene. P., Meeting, Feather picking and feather loss. Pages 227–238 in 27th Poultry Science Symposium of the World‟s Poultry Science Association. Bristol, England. Welfare of the Laying Hen, 2004.

20. Sossinka, R., Domestication in birds. Pages 373–403 in Avian Biology. Vol. VI. D. S. Famer, J. R. King, and K. C. Parkes, ed. Academic Press, New York, NY. 1982.

21. Yousef, M. K., Stress Physiology in Livestock. Vol. I, Basic Principles. CRC Press, Boca Raton, FL. 1985.


203

PLURIPOTENT STEM CELLS FOR CARDIAC REPAIR AND RECELLULARIZATION

CSILLA ZAMBORI

1, A.A. MORVAY

1, MIRABELA CRISTEA

4, E. TIRZIU

3,

V. PĂUNESCU2

1National Institute of Research – Development in the Pathology Domain and

Biomedical Sciences “Victor Babes”, 050096, Splaiul Independentei no. 99-101, Bucharest, Romania

2University of Medicine and Pharmacy “Victor Babes” Timisoara, Romania

3Banat‟s University of Agricultural Sciences and Veterinary Medicine, King Michael

I of Romania, Timisoara, Romania 4Emergency County Hospital Timisoara


Summary

The adult human heart has very limited capability to regenerate and that is why it is necessary to determine the optimal, effective and safety cardiac cell therapy in different cardiac diseases such as in myocardial infarction.

Using stem cell – based therapies for people suffering an acute myocardial infarction or those with congestive heart failure has encountered the imagination of both the medical and public individuals. For these porpoise human embryonic stem cells (hESC), pluripotent stem cells, and human induced pluripotent stem (iPS) cells are important sources for different methods used for cardiac repair and most recently for creating a bioartificial heart by decellularization and recellularization. For example human ES cells can differentiate into spontaneously beating cells with a cardiomyocyte phenotype. Other potential sources of cells which are used for cardiac repair are the autologous skeletal myoblasts because of their biological properties. Bone marrow stem cells promote cardiomyocyte and endothelial cell formation after myocardial infarction and congestive heart failure. Mesenchymal stem cells can differentiate into cardiomyocytes and endothelial cells in vivo after transplantation in both noninjury and with myocardial infarction hearts. Hematopoietic stem cells (HSCs) are multipotent stem cells, which can also have the capacity to differentiate into a number of cells, including cardiomyocytes and endothelial cells. It has been discovered that the heart has endogenous regenerative potential by resident cardiac stem cells. Umbilical cord blood (UCB) is an important source of both hematopoietic stem cells and mesenchymal precursor cells. Other important sources are induced pluripotent stem cells which are reprogramed adult somatic cells into pluripotent stem cell lines that can differentiate into functional cardiomyocytes. Using stem cells for cardiac repair and recellularization of bioartificial hearts is a real challenge for both researchers and clinical practitioners. Herein we review the current status of the cardioregenerative role of pluripotent stem cells.

Key words: bioartificial heart, cardioregenerative, cardiomyocyte, recellularization,

stem cells

Stem cell biology has become an important field of interest in the recent

years. Stem cell therapy has a tremendous role in the treatment of many diseases


204

by transplantation therapy. There are several varieties of stem cells that have been isolated and identified in vivo and in vitro. It well known there are three major classes of stem cells: embryonic/fetal stem cells and adult stem cells.

Currently the most important applications of human stem cells are the generation of cells and tissues that could be used in therapies that undergo the evaluation of these cells.

Stem cells are unspecialized cells that are capable of becoming specialized cells, with new cell functions. These cells have the properties of developing into a lot of cell types in the human body and serve as a permanent repair system by the ability to divide without limit and to replace other cells. When a stem cell has divided, the new cell will have the potential to either remain as a stem cell or to become another cell type with new functions (11).

Stem cell–based therapies which are used for patients suffering an acute myocardial infarction (MI) or other heart diseases have captured the interest of both medical and popular communities. Heart regeneration therapies with stem cells could resolve different heart diseases for millions of patients. An important role of cardiac stem cell research is the engraftment of beating cardiac cells into the ischemic region of the heart after a myocardial infarction or more recently for the recelullarization in vitro of the decelullarizated heart for the reconstruction of a bioartificial heart.

Sources of stem cells used for cardiac repair and recellularization 1. Embryonic pluripotent stem cells (ES) (15, 26, 74); 2. Induced pluripotent stem cells (iPS) (17, 59, 70, 81); 3. Adult bone marrow stem cells: mesenchymal stem cells,

hematopoietic stem cells, endothelial progenitor stem cells (2, 21, 61); 4. Skeletal myoblasts (11, 18); 5. Organ specific cells (11). Embryonic stem cells The human embryonic stem cells (hESCs) have unlimited expansion

capacity and plasticity, and are a pluripotent reservoir for in vitro proliferation of large number of human somatic cells needed for cardiac repair and regeneration (68, 76).

Specifically, embryonic stem cells are derived from the inner cell mass of the blastocyst before it would implant in the uterine wall. Results of the experiments conducted on mice have shown that embryonic stem cells could contribute to the differentiation of all cell lines including the germinal one (81). In 1998, Thomson et al. (76) have led to the conclusion that ES cell lines can derivate from human blastocysts obtained from human eggs fertilized in vitro.

ES cells have the ability to differentiate into spontaneously beating cells with a specific cardiomyocyte phenotype. In myocardial infarction there is a significant loss of cardiomyocytes (CMs). The functional CMs that are differentiated


205

from human embryonic stem cells (hESCs) are an important unlimited cell source for different cardiac disease therapies and regenerative cardiovascular medicine. It was seen that after transplantation into the infarcted myocardium, ES cell – derived cardiomyocytes have the ability to engraft and improve cardiac function in several rodents (3).

Also regarding to the role of ES cells in cardiac therapy it was observed that both murine and human ES cells can spontaneously differentiate and form endothelial and smooth muscle cells in vitro and in vivo (38, 39, 47).

Kehat et al. (44) have studied the derivation of cardiomyocytes from hES cells. In their study it was seen that cardiomyocytes have spontaneous contractions in EBs (embryoid body). Spontaneous contractions were observed after 11 days of plating, and only 8.1% of the EBs contained beating areas, composed primarily of small mononuclear (9).

More recently there were used different techniques and methods such as genetic modification, specialised culture methods, and treatment with chemical and biological factors to obtain functionally ESC-CMs generated from heterogeneous ESCs (34, 50). For example Chong and colleagues (13) have succeeded to generate cardiomyocytes from ESCs which were used successfully to engraft and repair the injured myocardium in a primate model with myocardial infarction.

Culturing human embryonic cells from embryos after in vitro fertilization have lead to contradictory discussions on the future applications of human embryonic cells in regenerative medicine (76). There were seen several difficulties regarding their genetic instability, tumorigenic potential, different immunogenic properties, ethical considerations by the use of human embryos and the problem of reaction of the tissue transplant reject. Regarding to this researchers are trying to resolve these problems by generating pluripotent cells directly from patients own cells by reprogramming of differentiated cells to pluripotent embryonic stem cells.

There are three ways of reprogramming adult cells: through nuclear transfer, fusion with embryonic stem cells and the action of defined factors.

Induced pluripotent stem cells (iPS) Reprogramming by fusion with embryonic stem cells In 1976, Miller and Ruddle (59) highlighted the pluripotent ability of the

cells by fusion of thymocytes with embryonic carcinoma. Similar results were obtained by electro-fusion with mouse embryonic stem cells (74). Later it was demonstrated the ability of reprogramming cells through fusion with human embryonic stem cells (15, 82).

Reprogramming by nuclear transfer An important aspect when taking into consideration the capacity of nuclear

transfer for the generation of pluripotent stem cell lines is the availability of human oocytes. Recently Egli et al. (17) have found out that pluripotent cells can be generated through nuclear transfer using adult somatic cells as donors and zygotes as receptors.


206

Reprogramming with defined factors It was hypothesized that the factors that are supposed to maintain the

identity of embryonic stem cells also play an important role in the induction of pluripotency of somatic cells.

As embryonic stem cells, induced pluripotent stem cells have limited capacity and broad replication capacity of differentiation, cloning, genetic instability and tumoral risk. In 2006 and 2007 Takahashi and Yamanaka (75, 81) have discovered that embryonic fibroblasts and adult mouse fibroblasts can be induced to become pluripotent stem cells by retroviral transduction by four transcription factors OCT3/4, SOX2, c-MYC, and KLF4. Mouse iPS cells are outstanding, very much alike embryonic stem cells in terms of proliferation, morphological aspects, genetic and expression the capacity of teratoma formation. Reprogramming of fibroblasts to induced pluripotent stem cells (iPS), suggests the possibility that a somatic cell could be rescheduled without becoming a stem cell/progenitor cells.

More recently Christoforou et al. (14) have shown that mouse iPS - derived cardiac progenitors are multipotent and capable of differentiating into cardiomyocytes, smooth muscle, and endothelial cells. They came to the conclusion that cardiac progenitor-descendent cardiomyocytes can achieve a structural and functional maturity in vitro which can adhere to engineered tissues and form functional tissues in a 3D environment. Therefore iPS cell-derived cardiac progenitors may be an important source for cell and tissue engineering therapies for different heart diseases (14). The same results were obtained by Nelson et al. which have shown that human iPSs have an important role in regeneration of the myocardium, smooth muscle and endothelial tissue, restoring post - ischemic contractility performance and electric stability after implantation in mouse models of myocardial infarction (64).

Mesenchymal stem cells Friedenstein et al. (23) were the first researchers which showed that MSCs

can differentiate into mesoderm-derived tissue and have an important role in regulating haematopoiesis. Later Makino et al. (52) have demonstrated the ability of mouse BM-derived MSCs to form cardiomyocytes in vitro (52). These findings were completed by Toma et al. (78) which highlighted the same results in vivo.

Many in vivo studies in small and large animals have displayed that mesenchymal stem cells transplantation has different beneficial effects. Experiments on rodents showed that MSCs treatment leads to a reduction of infarct size, a higher number of blood vessels in the ischemic tissue, reduced number of apoptotic cells in the infarct border zone, and better contractile function, but the formation of actual neocardiomyocytes in vivo remains uncertain (78). Numerous in vivo and in vitro studies showed that MSCs have the capacity to develop a myocyte lineage axis and after stimulation and transplantation can express cardiomyocyte-specific markers. For example prestimulation of MSC with different growth factors and citokines can improve their functional capacity in cardiac regeneration (6).


207

Electrostimulation is another method used for stimulating the differentiation of MSC towards cardiomyocytes. (28, 29). Today there are described many other strategies in order to promote cardiomyogenic differentiation of MSC. Numerous studies were made to show the epigenetic modulation of the transcriptional profile by DNA demethylation with 5-azacytidine. It was observed that MSC treated with 5-azacytidine have different phenotypes and spontaneously beating myocyte-like cells can be isolated (33).

However there are different contradictory studies which suggest that at different commonly used concentrations 5-azacytidine inhibits proliferation and induces apoptosis of mouse bone marrow-derived mesenchymal stem cells because of its geno-toxic effect (22). In conclusion the mechanism of cardiomyogenic differentiation with 5-azacytidine remains unclear.

Another frequently used method is MSC differentiation towards cardiomyocytes in co-culture with neonatal rat cardiomyocytes. Xiao Hong Li et al. (80) have created the cardiac microenvironment in vitro by co-culturing myocardial cells with BMSCs with semipermeable membranes. Their results confirmed that BMSCs could have the capacity to differentiate into CLCs in the myocardial environment (80). Also different co-cultures were made with BMSCs and mature cardiomyocytes (66, 79) or cardiomyocyte extracts. These results were uncertain and controversial.

As taking into consideration the previous data, differentiation of mesenchymal stem cells towards cardiomyocytes is possible in vitro but the real problem remains their differentiation in vivo.

Preclinical and clinical researches on animals and humans have demonstrated that using MSCs for cardiac regeneration therapy is efficient. Still there are many aspects that must be resolved in the near future. It is important to find new strategies in discovering new methods for efficient engraftment and specific cell differentiation and resolving the problems of low retention of cardiac stem cells (62).

Hematopoietic stem cells Hematopoietic stem cells (HSCs) are multipotent stem cells which can

differentiate into different cell lines including cardiomyocytes and which have been isolated based on cell-surface markers. These stem cells are able to proliferate and migrate from bone marrow to peripheral circulation and inhabit the injury leading to myocardial repair and regeneration. Fukata M. et al. (24) reported that HSCs could differentiate towards cardiomyocytes via myeloid intermediates by fusion-dependent mechanism (24). An important role of HSCs in cardiovascular repair is that these stem cells favour the processes of myogenesis and angiogenesis (69).

Orlic et al. (67) were the first which have shown that transplanted bone marrow-derived cells (BMCs) have the ability to regenerate the infarcted myocardium. They have demonstrated that HSCs –enriched bone marrow (marked by Lin-/c-kit+ or side population) have the capacity to trans-differentiate into mature


208

cardiomyocytes, smooth muscle cells, and endothelial cells in a murine model of MI. Regarding to this there are other several studies that claim the ability of HSCs to trans-differentiate into cardiovascular cells (51, 72). Despite of this Orlic et al. (67) have showed that HCSs have an important role in cardiac injury therapy. Finally it is supposed that transplanted HSC's may have an important role in stimulating angiogenesis and infarct healing by their paracrine effects on myocytes and even on resident cardiac progenitor cells (30, 31, 60).

Endothelial progenitor stem cells Asahara et al. (4) were the first to describe the bone marrow-derived,

circulating endothelial progenitor cells (EPCs) in 1997. EPCs have an important role in vessel wall homeostasis and in vascular regeneration by endothelial cell repair. Endothelial progenitor stem cells are bone marrow derived peripheral blood mononuclear cells that have the capacity to proliferate, migrate, and differentiate into mature endothelial cells. Endothelial progenitor cells can be isolated from the bone marrow but also can be found in the peripheral blood and human umbilical cord blood (12). It is well known that in peripheral blood and bone marrow the number of EPCs is very low and that is why is very difficult to expand ex vivo a sufficient number of cells necessary for different clinical therapeutics.

Jian-Yong et al. (41) have demonstrated that endothelial progenitor stem cells have an important role for treatment of cardiovascular disease.

Kawamoto et al. (43) demonstrated that EPCs have different physiological functions which contribute to the reduction of myocardial ischemia and infarction. They have made some experiments in rats and demonstrated the role of EPC in the acute myocardial infarction therapy by reducing myocardial fibrosis after intravenous administrations of ex vivo expanded human EPCs. It is known that circulating EPCs levels are considered as biomarkers for coronary and peripheral artery disease. Still the mechanisms by which EPCs intervene in cardiovascular therapy are unclear.

Skeletal myoblasts Autologous skeletal myoblasts known as skeletal muscle satellite cells are

other important cell source for cardiac regeneration. Skeletal myoblasts can be found normally in a quiescent state between the basement membrane and the sarcolemma of individual muscle fibres. These cells have important regenerative proprieties for skeletal muscle tissues. Skeletal myoblasts have the ability to proliferate, self-renew and differentiate in muscle injuries (48).

After injury the cells in this quiescent state differentiate into myoblasts and express Myf5 and MyoD, which are important in myogenic differentiation, and desmin, which is important in linking myofibrils. At last these myoblasts will fuse with the existing muscle fibres and form new fibres (58).

Different clinical trials made on small and large animals with ischemic and non-ischemic cardiomyopathies revealed that the number of surviving myoblasts


209

injected into damaged myocardium is small. Despite of this they have an important role in engraftment and improvement of global cardiac pump function but the exact mechanism of action is still unknown (16).

More preclinical studies on patients with ischemic heart disease have highlighted the successful role of myoblast transplantation into the post-infarction sites of the heart (32, 37, 55, 56, 57).

Although skeletal myoblasts have some common proprieties with cardiomyocytes they do not form gap-junctions and do not make connections with cardiomyocytes. They also tend to have a strictly commitment to a myogenic lineage. There were made different experiments in order to overexpress gap-junctions of myoblasts but it is not clear yet if these myoblasts will be homogenous enough in order to synchronize contractions of the graft with the cardiomyocytes of the host (35). Researches regarding the role of myoblast in cardiac therapy are still in progress and there is a continuous need in improvement of the pathway of delivery, the survival and number of the engrafted cells.

Organ specific cells (resident cardiac stem cells) For long time it was supposed that the heart is the organ that is incapable

of generating new cells. Different researches have highlighted that the heart has an endogenous

regenerative capacity. There are studies which have demonstrated that the murine and human heart has some potential clonogenic cells which have the same proprieties with cardiac stem cells. These stem cells are resident cardiac progenitor cells and cardiac stem cells (CSCs) that have the capacity to express the stem cell surface marker c-kit in the adult rat and human heart. CSCs and cardiac progenitor express mixed types of stem cell markers (7). These cells can be isolated from cardiac tissue during heart surgery or by endocardial biopsy. After isolation CSCs can be expanded in culture and used for autologous transplantation (73).

Cardiac progenitor cells are considered immature cells with myocytes cell proprieties that can proliferate and mature into precursors and differentiate towards matured cardiac like cell types. CSCs may be the best cell types used for cardiovascular cell therapy, because they are tissue-specific and have different proprieties which favour their differentiation towards cardiovascular lineages. CSCs are cells that can be found in specific areas of the heart, such as the atria or pericardium. It is known that (CSCs) are able to generate new myocytes and blood vessels (7). CSCs have an important role in cardiac regeneration because of their ability to undergo cardiomyogenic and angiogenic differentiation and can obtain structural proprieties of mature myocytes and vessels faster than BMCs (50).

It is supposed that CSCs can generate new myocardium by replacing the cells lost in MI. However the proliferation and regeneration capacity of CSCs are at very low rates. So to be used in clinical cardiac therapy these cells must be expanded ex vivo (1).


210

Also in order to use these stem cells for myocardial regeneration repair it is necessary to stimulate them effectively (19). However, major difficulties exist in the isolation of CSCs from myocardial samples, reducing available CSCs to be used for implantation (49).

Some research data revealed that c-kit-marked resident cardiac stem cells (CSCs) are both necessary and sufficient for cardiac regeneration, and that the differentiation of CSCs into cardiac myocytes constitutes the primary mechanism for cellular replacement following diffuse, isoproterenol (ISO)-induced injury to the heart (19).

There are two important clinical trials in which there are described some results after transplantation of autologous cells with human progenitor characteristics. In the SCIPIO phase 1 trial it was demonstrated that there was a 12.3% improvement in LVEF in patients 1 year after intracoronary injection with autologous c-kit+, lineage–CPCs following myocardial infarction (10). Another clinical trial was the CADUCEUS trial. In this trial patients 2–4 weeks postmyocardial infarction received an intracoronary injection of cardiosphere-derived autologous stem cells or standard of care (53).

It was observed that there were no significant differences regarding global function (LVEF) between these two clinical trials. Although it was seen an improvement and increase of regional contractility after cardiac magnetic resonance imagining (MRI). Also autologous transplantation of these cells had led to the reduction of the scar mass and favoured an increase of viable tissue (27, 53).

Umbilical cord blood stem cells Umbilical cord blood (UCB) is an important source of both hematopoietic

stem cells and mesenchymal precursor stem cells. These stem cells are collected postnatal from the umbilical cord respectively umbilical cord vein, umbilical cord matrix, amnion/placenta, and are an important source of cells that are capable of forming many different cell types including cardiomyocytes. Over the years, considerable preclinical efforts have been made to explore appropriate stem cell sources for cardiac repair and regeneration including those from umbilical cord blood (UCB). It is well known that stem cells from UCB are much more numerous that cells from adult blood and bone marrow and that some of these cells are potential sources for cardiac repair.

For example Kadivar et al. (42) and Nishiyama et al. (65) have demonstrated the differentiation of UCBMSCs into the cardiomyogenic lineage in vitro. In contrary there were made different experiments that have failed to reveal such differentiation (54, 71) with 5-azacytidine (65), dimethyl sulfoxide (54), a combination of growth factors involved in early cardiomyogenesis (71), activation of Wnt signaling pathways (46, 63) and co-culture with neonatal rat cardiomyocytes (5).


211

Kogler et al. (45) have isolated some fibroblast like cells from human UCB known as unrestricted somatic stem cells capable of differentiating, both in vitro and in vivo, into different types of tissues, including cardiomyocytes.

Gaebel et al. (25) have administrated intramyocardially CD105+UCBMSCs in infarcted mouse hearts. They observed an increase of capillary density in injured zones 6 weeks after infarction and an improving of cardiac function. These results confirmed the experiment made earlier by Hirata et al.(40) which observed an improvement of cardiac function after the injection of UCB CD34 into the peri-infarct rim after myocardial infarction (40). Nowadays there are numerous experiments made with hUCBCs for the development of vascular grafts and heart valves for newborns with congenital heart problems. Unfortunately until today the researches regarding clinical testing on cardiac regeneration of UCBMSCs do not have outstanding results but the experiments are still in progress (35). Despite of this UCBMSCs are considered important possible therapeutic sources for different human diseases.

Conclusions

Stem cell biology has a tremendous potential future for cardiac therapy.

The remaining real challenges of stem cell applications in cardiac diseases are to evaluate the existing potential negative effects in order to guide safety clinical applications.

Therefore new and continuous researches must be made in order to improve and increase the survival rate of stem cells after transplantation and to favor the most effective engraftment of these cells that can finally be used for clinical purposes.

Also it is important and necessary to perform studies that can compare different stem cell types at the same time point with minimal variability and clinical trials which should identify optimal data regarding differentiation, proliferation, and integration with the host heart.

It is for sure that stem cells remain one of the most important sources for the treatment of a different cardiac disorders but because of the limited availability of this resource additional research studies are needed to promote cardiac tissue regeneration by finding out optimal systems to maintain the delivered stem cells in the heart and to track them during transplantation.

Acknowledgments

This study was supported by the project Dezvoltarea infrastructurii de

cercetare, educaţie şi servicii în domeniile medicinei veterinare şi tehnologiilor inovative pentru RO 05, cod SMIS-CSNR 2669 and by the Sectorial Operational Programme Human Resources Development (SOPHRD), financed by the


212

European Social Fund and the Romanian Government under the contract number POSDRU 141531 awarded to Csilla Zambori.

References

1. Abbott, J., Giordano F., Stem cells and cardiovascular disease, J Nucl

Cardiol, 2003, 10, 4, 403–412. 2. Anastasiu, D., Bojin, F., Gluhovschi, A., Stoian, D., Balu, S., Vizitiu, A.,

Bold, T., Craina, M., Păunescu, V., REVIEW: Stem Cells and the Placental Stem Cells, Revista de Fiziologie, 2013, (78), 4-10.

3. Andrew, J.B., Steven, P.S., Joshua, M.H., Stem Cell Therapy for Cardiac Repair: Ready for the Next Step Circulation, 2006, 114, 339-352.

4. Asahara, T., Murohara, T., Sullivan, A., Isolation of putative progenitor endothelial cells for angiogenesis, Science, 1997, 275, 964-967.

5. Badorff, C., Brandes, R.P., Popp, R., et al., “Transdifferentiation of blood-derived human adult endothelial progenitor cells into functionally active cardiomyocytes,” Circulation, 2003, 107, 7, 1024–1032.

6. Behfar, A., Yamada, S., Crespo-Diaz, R., Nesbitt, J.J., Rowe, L.A., Perez-Terzic, C., Gaussin, V., Homsy, C., Bartunek, J., and Terzic, A., Guided cardiopoiesis enhances therapeutic benefit of bone marrow human mesenchymal stem cells in MSCs FOR CARDIAC CELL THERAPY 11 chronic myocardial infarction, J. Am. Coll. Cardiol., 2010, 56, 721–734.

7. Beltrami, A.P., Barlucchi, L., Torella, D. et al., Adult cardiac stem cells are multipotent and support myocardial regeneration, Cell, 2003, 114, 6, 763–776.

8. Bernstein, H.S., Cardiac repair and restoration using human embryonic stem cells, Regen Med, 2012, 7, 697.

9. Boheler, K.R., Czyz, J., Tweedie, D., Yang, H.T., Anisimov, S.V., Wobus, A.M., Differentiation of pluripotent embryonic stem cells into cardiomyocytes. Circulation Research. 2002, 91, 189-201.

10. Bolli, R., Chugh, A.R., D’Amario, D., Loughran, J.H., Stoddard, M.F., Ikram, S., Beache, G.M., Wagner, S.G., Leri, A., Hosoda, T., et al., Cardiac stem cells in patients with ischaemic cardiomyopathy (SCIPIO): initial results of a randomised phase 1 trial. Lancet, 2011, 378, 1847–1857.

11. Bongso, A., Lee, E.H., Stem cells: from bench to bedside; Chapter 1 – Stem cells: Their definition, classification and sources. World scientific publishing Co. Pte. Ltd., 2005.

12. Borlongan, C.V., Glover, L.E., Tajiri, N., Kaneko,Y., Freeman, T.B., The great migration of bone marrow-derived stem cells toward the ischemic brain: therapeutic implications for stroke and other neurological disorders Prog Neurobiol, 2011, 95, 2, 213–228.


213

13. Chong, J.J., Yang, X., Don, C.W., Minami, E., Liu, Y.W., Weyers, J.J., Human embryonic-stem-cell-derived cardiomyocytes regenerate non-human primate hearts. Nature 2014, 510, 273-277.

14. Christoforou, N., Liau, B., Chakraborty, S., Chellapan, M., Bursac, N., Leong, W.K., Induced Pluripotent Stem Cell-Derived Cardiac Progenitors Differentiate to Cardiomyocytes and Form Biosynthetic Tissues, PloS ONE, 2013, 8, 6, e65963.

15. Cowan, C.A., Atienza, J., Melton, D.A., Eggan, K., Nuclear reprogramming of somatic cells after fusion with human embryonic stem cells, Science, 2005, 309, 1369–1373.

16. Dowell, J.D., Rubart, M., Pasumarthi, K.B., Soonpaa, M.H., Field, L.J., Myocyte and myogenic stem cell transplantation in the heart, Cardiovasc Res, 2003, 58, 336 –350.

17. Egli, D., Rosains, J., Birkhoff, G., Eggan, K., Developmental reprogramming after chromosome transfer into mitotic mouse zygotes, Nature., 2007, 447(7145), 679-85.

18. Eiges, R., Schuldiner, M., Eden, R., Yanuka, A., Itskovitz-Eldor, O., Goldstein, R.S., Benvenisty, N., Induced neuronal differentiation of human embryonic stem cells, Brain Res, 2001, 913, 201–205.

19. Ellison, G.M., Galuppo, V., Vicinanza, C., Aquila, I., Waring, C.D., Leone, A., et al., Cardiac stem and progenitor cell identification: different markers for the same cell? Front Biosci 2010, 2, 641-652.

20. Ellison, G.M., Vicinanza, C., Smith, A.J., et al., Adult c-kit(pos) cardiac stem cells are necessary and sufficient for functional cardiac regeneration and repair, Cell, 2013, 154, 827–842.

21. Evans, M.J., Kaufman, M.H., Establishment in culture of pluripotential cells from mouse embryos, Nature, 1981, 292, 154–156.

22. Fenxi, Z., Junfang, W., Ming, L., Huaibin, W., Huigen, F., 5-Azacytidine inhibits proliferation and induces apoptosis of mouse bone marrow-derived mesenchymal stem cells, Toxin Reviews, 2013, 32, 4, 55-59.

23. Friedenstein, A.J., Chailakhyan, .K. Latsinik, N.V., “Stromal cells responsible for transferring the microenvironment of the hemopoietic tissues. Cloning in vitro and retransplantation in vivo,” Transplantation, 1974, 17, 4, 331–340.

24. Fukata, M., Ishikawa, F., Najima, Y. et al., Contribution of bone marrow-derived hematopoietic stem/progenitor cells to the generation of donor-marker(+) cardiomyocytes in vivo PLoS One, 2013, 8, 5, p. e62506.

25. Gaebel, R., Furlani, D., Sorg, H. et al., “Cell origin of human mesenchymal stem cells determines a different healing performance in cardiac regeneration,” PLoS ONE, 2011, vol. 6, no. 2. e15652.

26. Garban, Z., Biologie moleculară: concepte, metode, aplicaţii, Ediţia a 6-a, Editura Solness, Timişoara, 2009.


214

27. Garbern, J.C., Lee, R.T., Cardiac Stem Cell Therapy and the Promise of Heart Regeneration Cell Stem Cell, 12, 689-698.

28. Ge, D., Liu, X., Li, L., Wu, J., Tu, Q., Shi, Y., Chen, H., Chemical and physical stimuli induce cardiomyocyte differentiation from stem cells, Biochem. Biophys. Res. Commun., 2009, 381, 317–321.

29. Genovese, J.A., Spadaccio, C., Chachques, E., Schussler, O.,Carpentier, A., Chachques, J.C., Patel, A.N., Cardiac pre-differentiation of human mesenchymal stem cells by electrostimulation, Front. Biosci., 2009, 14, 2996–3002.

30. Gnecchi, M., He, H., Liang, O.D., et al., Paracrine action accounts for marked protection of ischemic heart by Akt-modified mesenchymal stem cells, Nat Med, 2005, 11, 367–368.

31. Grunewald, M., Avraham, I., Dor, Y., et al., VEGF-induced adult neovascularization: recruitment, retention, and role of accessory cells, Cell, 2006, 124, 175–189.

32. Hassink, R.J., Dowell, J.D., Brutel de la Riviere, A., Doevendans, P.A., Field, L.J., Stem cell therapy for ischemic heart disease, Trends Mol Med, 2003, 9, 436–441.

33. Hattan, N., Kawaguchi, H., Ando, K., Kuwabara, E., Fujita, J., Murata, M., Suematsu, M., Mori, H., Fukuda, K., Purified cardiomyocytes from bone marrow mesenchymal stem cells produce stable intracardiac grafts in mice, Cardiovasc. Res., 2005, 65, 334–344.

34. He, W., Ye, L., Li, S., Liu, H., Wang, Q., Fu, X., et al., Stirred suspension culture improves embryoid body formation and cardiogenic differentiation of genetically modified embryonic stem cells, Biol Pharmaceut Bull 2012, 35, 308-316.

35. Henning, R.J., Stem Cells In Cardiac Repair - Recent Developments And Future Directions, Interventional Cardiology, 2012, 7, 1, 10-13.

36. Henning, R.J., Stem Cells in Cardiac Repair, Disclosures Future Cardiol, 2011, 7, 1, 99-117.

37. Herreros, J., Prosper, F., Perez, A., Gavira, J.J., Garcia-Velloso, M.J., Barba, J., Sanchez, P.L., Canizo, C., Rabago, G., Marti-Climent, J.M., Hernandez, M., Lopez-Holgado, N., Gonzalez-Santos, J.M., Martin-Luengo, C., Alegria, E., Autologous intramyocardial injection of cultured skeletal muscle-derived stem cells in patients with non-acute myocardial infarction, Eur Heart J, 2003, 24, 2012–2020.

38. Hill, J.M., Dick, A.J., Raman, V.K.,Thompson, R.B., Yu, Z.X., Hinds, K.A., Pessanha, B.S., Guttman, M.A., Varney, T.R., Martin, B.J., Dunbar, C.E., McVeigh, E.R., Lederman, R.J. Serial cardiac magnetic resonance imaging of injected mesenchymal stem cells, Circulation, 2003, 108, 1009 –1014.

39. Himes, N., Min, J.Y., Lee, R., Brown, C., Shea, J., Huang, X., Xiao, Y.F., Morgan, J.P., Burstein, D., Oettgen, P., In vivo MRI of embryonic stem


215

cells in a mouse model of myocardial infarction, Magn Reson Med, 2004, 52, 1214–1219.

40. Hirata, Y., Sata, M., Motomura, N., Takanashi, M., Suematsu, Y., Ono, M., Takamoto, S., Human umbilical cord blood cells improve cardiac function after myocardial infarction. Biochem Biophys Res Commun. 2005, 327, pp. 609–614.

41. Jian-Yong, X., Yee-Ki, L., Wang, Y., Hung-Fat, T., Therapeutic application of endothelial progenitor cells for treatment of cardiovascular diseases., Curr Stem Cell Res Ther, 2014, 9, 5, 401–414.

42. Kadivar, M., Khatami, S., Mortazavi, Y., Shokrgozar, M.A., Taghikhani, M., Soleimani, M., “In vitro cardiomyogenic potential of human umbilical vein-derived mesenchymal stem cells,” Biochemical and Biophysical Research Communications, 2006, 340, 2, 639–647.

43. Kawamoto, A., Gwon, H.C., Iwaguro, H., Yamaguchi, J.I., Uchida, S., Masuda, H., Silver, M., Ma, H., Kearney, M., Isner, J.M., Asahara, T., Therapeutic potential of ex vivo expanded endothelial progenitor cells for myocardial ischemia, Circulation 2001, 103, 634-637.

44. Kehat, I., Kenyagin-Karsenti, D., Snir, M., Segev, H., Amit, M., Gepstein, A., Livne, E., Binah, O., Itskovitz-Eldor, J., Gepstein, L., Human embryonic stem cells can differentiate into myocytes with structural and functional properties of cardiomyocytes, J Clin Invest, 2001, 108, 407–414.

45. Kogler, G., Sensken, S., Airey, J.A., Trapp, T., Muschen, M., Feldhahn, N., Liedtke, S., Sorg, R.V., Fischer, J., Rosenbaum, C., Greschat, S., Knipper, A., Bender, J., Degistirici, O., Gao, J., Caplan, A.I., Colletti, E.J., Almeida-Porada, G., Muller, H.W., Zanjani, E., Wernet, P., A new human somatic stem cell from placental cord blood with intrinsic pluripotent differentiationpotential. J Exp Med, 2004, 200, 123–135.

46. Koyanagi, M., Haendeler, J., Badorff, C., et al., “Non-canonical Wnt signaling enhances differentiation of human circulating progenitor cells to cardiomyogenic cells,” The Journal of Biological Chemistry, 2005, 280, 17, 16838–16842.

47. Kraitchman, D.L., Heldman, A.W., Atalar, E., Amado, L.C., Martin, B.J., Pittenger, M.F., Hare, J.M., Bulte, J.W., In vivo magnetic resonance imaging of mesenchymal stem cells in myocardial infarction, Circulation, 2003, 107, 2290–2293.

48. Kuethe, F., Figulla, H.R., Herzau, M., Voth, M., Fritzenwanger, M., Opfermann, T., Pachmann, K, Krack, A., Sayer, H.G., Gottschild, D., Werner, G.S.,Treatment with granulocyte colony-stimulating factor for mobilization of bone marrow cells in patients with acute myocardial infarction. Am Heart J, 2005, 150:115.


216

49. Leri, A., Kajstura, J., Anversa, P., Frishman, W.H., Myocardial regeneration and stem cell repair Curr Problems Cardiol, 2008, 33, 3, 91–153.

50. Li, T.S., Cheng, K., Malliaras, K., Smith, R.R., Zhang, Y., Sun, B., et al., Direct comparison of different stem cell types and subpopulations reveals superior paracrine potency and myocardial repair efficacy with cardiosphere-derived cells.J Am Coll Cardiol, 2012, 59, 942-953.

51. Lundy, S.D., Gantz, J.A., Pagan, C.M., Filice, D., Laflamme, M.A., Pluripotent stem cell derived cardiomyocytes for cardiac repair Curr Treat Options Cardiovasc Med, 2014, 16, 7, 319.

52. Makino, S., Fukuda, K., Miyoshi, S. et al., “Cardiomyocytes can be generated from marrow stromal cells in vitro,” Journal of Clinical Investigation, 1999, 103, 5, 697–705

53. Makkar, R.R., Smith, R.R., Cheng, K., Malliaras, K., Thomson, L.E., Berman, D., Czer, L.S., Marba’n, L., Mendizabal, A., Johnston, P.V., et al., Intracoronary cardiosphere-derived cells for heart regeneration after myocardial infarction (CADUCEUS): a prospective, randomised phase 1 trial. Lancet, 2012, 379, 895–904.

54. Martin-Rendon, E., Sweeney, D., Lu, F., Girdlestone, J., Navarrete, C., Watt, S.M., “5-Azacytidine-treated human mesenchymal stem/progenitor cells derived from umbilical cord, cord blood and bone marrow do not generate cardiomyocytes in vitro at high frequencies,” Vox Sanguinis, 2008, vol. 95, no. 2, pp. 137–148.

55. Menasche, P., Hagege, A.A., Scorsin, M., Pouzet, B., Desnos, M., Duboc, D., Schwartz, K., Vilquin, J.T., Marolleau, J.P., Myoblast transplantation for heart failure. Lancet, 2001, 357, 279–280.

56. Menasche, P., Vilquin, J.T., Desnos, M., Early results of autologous skeletal myoblast transplantation in patients with severe ischemic heart failure. Circulation. 2001, 104 (suppl II): II-598.

57. Menasche, P., Hagege, A.A., Vilquin, J.T., Desnos, M., Abergel, E., Pouzet, B., Bel, A., Sarateanu, S., Scorsin, M., Schwartz, K., Bruneval, P., Benbunan, M., Marolleau, J.P., Duboc, D., Autologous skeletal myoblast transplantation for severe postinfarction left ventricular dysfunction. J Am Coll Cardiol, 2003, 41, 1078–1083.

58. Menasche, P., Skeletal myoblasts and cardiac repair. J. Mol. Cell. Cardiol., 2008, 45, 545–553.

59. Miller, R.A., Ruddle, F.H., Pluripotent teratocarcinoma-thymus somatic cell hybrids. Cell, 1976, 9, 45–55.

60. Mirotsou, M., Zhang, Z., Deb, A., et al., Secreted frizzled related protein 2 (Sfrp2) is the key Akt-mesenchymal stem cell-released paracrine factor mediating myocardial survival and repair. Proceedings of the National Academy of Sciences, 2007, 104, 1643–1648.


217

61. Mitalipov, S., Wolf, D., "Totipotency, pluripotency and nuclear reprogramming". Adv. Biochem. Eng. Biotechnol. Advances in Biochemical Engineering/Biotechnology, 2009, 114, 185–99.

62. Mohammad, T.E., Fatemat, H., Duaa, D., Marsh C.B., Ibrahim, A.A., Mahmood, K., Mesenchymal Stem Cells for Cardiac Regeneration: Translation to Bedside Reality. Stem Cells International Volume, 2012, Article ID 646038, 14 pages

63. Nakamura, T., Sano, M., Songyang, Z., Schneider, M.D., “A Wnt- and β-catenin-dependent pathway for mammalian cardiac myogenesis,” Proceedings of the National Academy of Sciences of the United States of America, 2003, 100, 10, 5834–5839.

64. Nelson, T.J., Martinez-Fernandez, A., Yamada, S., Perez-Terzic, C., Ikeda,Y., Terzic, A., “Repair of acute myocardial infarction by human stemness factors induced pluripotent stem cells,” Circulation, 2009, 120, 5, 408–416.

65. Nishiyama, M., Miyoshi, S., Hida, N., et al., “The significant cardiomyogenic potential of human umbilical cord blood-derived mesenchymal stem cells in vitro,” Stem Cells, 2007, 25, 8, 2017–2024.

66. Okamoto et al., 2007; Okamoto, K., Miyoshi, S., Toyoda, M., Hida, N., Ikegami, Y.,Makino, H., Nishiyama, N., Tsuji, H., Cui, C.H., Segawa, K., Uyama, T., Kami, D., Miyado, K., Asada, H., Matsumoto, K.,Saito, H., Yoshimura, Y., Ogawa, S., Aeba, R., Yozu, R., Umezawa, A. „„Working‟‟ cardiomyocytes exhibiting plateau action potentials from human placenta-derived extra embryonic mesodermal cells. Exp. Cell Res., 2007, 313, 2550-2562.

67. Orlic, D., Kajstura, J., Chimenti, S., Jakoniuk, I., Anderson, S., Li, B., et al., Bone marrow cells regenerate infarcted myocardium. Nature, 2001, 410, 701-705.

68. Parsons, X. H., Teng, Y. D., Snyder, E. Y., Important precautions when deriving patient-specific neural elements from pluripotent cells. Cytotherapy., 2009, 11, 815-824.

69. Qisi, S., Zhonge, Z., Zhongjie, S., The potential and challenges of using stem cells for cardiovascular repair and regeneration. Genes & Diseases, 2014, Volume 1, 1, 113–119.

70. Reubinoff, B.E., Pera, M.F., Fong, C.Y., et al., Embryonic stem cell lines from human blastocysts: somatic differentiation in vitro. Nat Biotechnol 2000; 18, 399-404.

71. Roura, S., Farré, J., Hove-Madsen, L., et al., “Exposure to cardiomyogenic stimuli fails to transdifferentiate human umbilical cord blood-derived mesenchymal stem cells,” Basic Research in Cardiology, 2010, vol. 105, no. 3, 419–430.

72. Sauer, H., Neukirchen, W., Rahimi, G., Grunheck, F., Hescheler, J., Wartenberg, M., Involvement of reactive oxygen species in cardiotrophin-


218

1-induced proliferation of cardiomyocytes differentiated from murine embryonic stem cells. Exp Cell Res, 2004, 294, 2, 313–324.

73. Smith, R.R., Barile, L., Cho, H.C., Leppo, M.K., Hare, J.M., Messina, E., Giacomello, A., Abraham, M.R., Marba, N.E., Regenerative potential of cardiosphere-derived cells expanded from percutaneous endomyocardial biopsy specimens. Circulation, 2007, 115, 896–908.

74. Tada, M., Takahama,Y., Abe, K.,. Nakatsuji, N., Tada, T., Nuclear reprogramming of somatic cells by in vitro hybridization with ES cells Curr. Biol., 2001, 11, 1553–1558.

75. Takahashi, K., Yamanaka, S., Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell, 2006, 126, 663–676.

76. Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J., Marshall, V.S., Jones, J.M., Embryonic stem cell lines derived from human blastocysts. Science. 1998, 6, 282(5391), 1145-7.

77. Tian, X., Hee, Cho,C.,Akar, F.G., Tsang, S.Y., Jones, P.S., Marbán, E., Tomaselli, G.F., Li, R.A., Functional integration of electrically active cardiac derivatives from genetically engineered human embryonic stem cells with quiescent recipient ventricular cardiomyocytes: insights into the development of cell-based pacemakers. Circulation, 2005, 4, 11, 11-20.

78. Toma, C., Pittenger, M.F., Cahill, K.S., Byrne, B.J., Kessler, P.D. “Human mesenchymal stem cells differentiate to a cardiomyocyte phenotype in the adult murine heart,” Circulation, 2002, vol. 105,1, 93–98.

79. Ventura, C., Cantoni, S., Bianchi, F., Lionetti, V., Cavallini, C., Scarlata, I., Foroni, L., Maioli, M., Bonsi, L., Alviano, F., Fossati, V., Bagnara, G.P., Pasquinelli, G., Recchia, F.A., Perbellini, A. Hyaluronan mixed esters of butyric and retinoic Acid drive cardiac and endothelial fate in term placenta human mesenchymal stem cells and enhance cardiac repair in infarcted rat hearts. J. Biol. Chem. 282, 2007, 14243–14252.

80. Xiao, H.L., Xi, Y.Y., Qiu, X.L., Chun, Y.D., Zhi, X.S., Min, Y., Shu, G.L., Bone marrow mesenchymal stem cells differentiate into functional cardiac phenotypes by cardiac microenvironment, Journal of Molecular and Cellular Cardiology, 2007, 42, 295–303.

81. Yamanaka, S., Strategies and New Developments in the Generation of Patient-Specific Pluripotent Stem Cells, 2007, Volume 1, Issue 1, pp. 39–49.

82. Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L., Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., et al., Induced pluripotent stem cell lines derived from human somatic cells. Science, 2007, 318, 1917–1920.


219

AUTHORS INDEX Ahmadi Mirela – 5 Apiš I. – 15 Ardelean V. – 25 Avram E. – 135 B Bărbuceanu Florica – 54 Belu C. – 54 Bojkovski J. – 15 Boldura Oana-Maria – 5 Bonca Gh. – 25 Borda Cristin – 161, 167 C Cauc Elena – 193 Cenariu M. – 148 Ciulan V. – 135 Colibar Olimpia – 30 Cosma Ş. – 87 Cristea Mirabela – 203 D Damian A. – 34, 81, 87, 156 Degen A. A. – 41 Deliš N. – 15 Diugan Eva Andrea – 161, 167 Dronca D. – 5 Dumitrescu I. – 54 Dumitru Ioana – 34 E El-Meccawi S. – 41 F Fluerasu L. – 188 G Georgescu B. – 54

Ghimpețeanu Oana-Mărgărita – 54 Ghiurco F. – 87 Groszler Astrid – 94 Groza I.S. – 148, 156 H Henegariu O. – 156 Hutu I. – 5, 67, 74 I Imre K. – 183 Irimescu Irina – 34, 81, 87 Irimie Alexandra – 156 J Jecan Carmen – 81, 87 K Kam M. – 41 Kocis Timea – 94 L Lazău A. – 125 Lătăreţu A. – 112 Lăzărescu C. – 94, 193, 197 M Maletiš J. – 15 Maletiš M. – 15 Martonoş C. – 81, 98 Mederle Narcisa – 106 Mihaela Adi Lupu – 148 Milovanov Cornelia – 5 Mircu C. – 5, 25, 67 Mitrănescu Elena – 112 Morar Adriana – 183 Morvay A. A. – 118, 203 Mot Maria – 30


220

N Nichita Ileana – 30, 125 Nuţ C. – 87 O Olariu-Jurca A. – 125, 135, 183, 188 Olariu-Jurca I. – 125, 135, 183, 188 Ordodi V. – 118 Oros Daniela – 161, 167 Otava G. – 25 P Pall Emoke – 142, 148 Paunescu V. – 118, 203 Pentea M. – 98, 183, 188 Pop A.R. – 156 Popescu Silvana – 161, 167 Popescu Sorina – 5 Predoi G. – 54 Purdoiu Letiția – 54 R Raita Ștefania Mariana – 54 Rață Georgeta – 106 Roman Alexandra – 142, 148 Roșu Petronela – 54

S Sala Claudia – 183 Samfira Mirela – 106 Silaghi F. – 34 Simion G. – 197 Sorescu Denisa – 30 Soritau Olga – 142 Stan F. – 173 Stancu A. – 125, 135, 183, 188 T Teslici Liliana Elena – 125 Țibru I. – 94, 193, 197 Tîrziu E. – 30, 118, 203 Tot Lydia – 94 Tudor L. – 112 Tulcan Camelia – 5 Tuns F. – 81 V Vakanjac S. Vasiš A. – 15 Vasiljeviš T. – 15 Vlaic Rebecca Gratziella – 161 Z Zambori Csilla – 118, 203 Zarcula Simona – 25 Zdravkoviš N. – 15


221

CONTENT

AHMADI MIRELA, OANA-MARIA BOLDURA, SORINA POPESCU, I. HUTU, C. MIRCU, CORNELIA MILOVANOV, D. DRONCA, CAMELIA TULCAN

Traditional versus commercial yogurt by biochemistry and molecular biology analytical methods

5

BOJKOVSKI J., M. MALETIŠ, S. VAKANJAC, N. ZDRAVKOVIŠ, A. VASIŠ, J. MALETIŠ, I. APIŠ, T. VASILJEVIŠ,

N. DELIŠ

Breeding and exploitation of boars on commercial farm

15

BONCA Gh., G. OTAVA, SIMONA ZARCULA, V. ARDELEAN, C. MIRCU

Eredopathological study of a Caucasian Shepherd puppy with genetic abnormalities

25

COLIBAR OLIMPIA, E. TÎRZIU, ILEANA NICHITA, MARIA MOT, DENISA SORESCU

Different ways of feeding turtles (Chrysemys scripta elegans)

30

DUMITRU IOANA, IRINA IRIMESCU, F. SILAGHI, A. DAMIAN

Comparative application of two mummification techniques on rabbit and cat cadavers

34

EL-MECCAWI S., M. KAM, A. A. DEGEN

Dietary selection in sheep and goats under free-grazing and penned conditions in the Negev, Israel

41

GEORGESCU B., G. PREDOI, C. BELU, I.DUMITRESCU, PETRONELA ROȘU, ȘTEFANIA MARIANA RAITA, LETIȚIA PURDOIU, OANA-MĂRGĂRITA GHIMPEȚEANU, FLORICA BĂRBUCEANU

The morphology of the vertebral column in Bengal tiger (Panthera tigris tigris) – case study

54


222

HUȚU I., C. MIRCU A study on formally inspected dairy cows’ milk – A case study

67

HUȚU I. Considerations on lactation in cattle under Romanian formal recording

74

JECAN CARMEN, A. DAMIAN, IRINA IRIMESCU, C. MARTONOŞ, F. TUNS

The asceding aorta in pigs - anatomical aspetcs -

81

JECAN CARMEN, A. DAMIAN, Ş. COSMA, C. NUŢ, F. GHIURCO, IRINA IRIMESCU

The postdiaphragmatic segment of the gastrointestinal tract in the dog and in the cat - A comparative anatomical study

87

KOCIS TIMEA, LYDIA TOT, ASTRID GROSZLER, I.ȚIBRU, C. LĂZĂRESCU

The assessment of serotonin in dogs 94

MARTONOS C., M. PENTEA Animal models in veterinary medicine from anatomical perspective

98

NARCISA MEDERLE, MIRELA SAMFIRA, GEORGETA RAȚĂ

Focus group (teachers) research in the frame of project ”Adopting of problem-based learning into veterinary nurse professional training”

106

MITRĂNESCU ELENA, L. TUDOR, A. LĂTĂREŢU

Research on the correlation between water temperature and hematological parameters of fish in a trout farm in Vâlcea district

112

MORVAY A. A., CSILLA ZAMBORI, V. ORDODI, E. TIRZIU, V. PAUNESCU

Methods and procedures for heart decellularization

118

OLARIU-JURCA A., A. STANCU, ILEANA NICHITA, LILIANA ELENA TESLICI, A. LAZĂU, I. OLARIU-JURCA

The morphopathological prevalence of uninflammatory nephropathies in dogs

125


223

OLARIU-JURCA I., ILEANA NICHITA, A.STANCU, V. CIULAN, E. AVRAM, A. OLARIU-JURCA

Morphopathological quantification of inflammatory nephropathies and tumours in dogs

135

PALL EMOKE, OLGA

SORITAU,

ALEXANDRA ROMAN

Chondrogenic differentiation of periodontal granulation tissue derived stem cells

142

PALL EMOKE, M. CENARIU, MIHAELA ADI LUPU, ALEXANDRA ROMAN, I.S. GROZA

Comparative functional assessement of palatal and umbilical cord blood mesenchymal stem cells

148

POP A.R., ALEXANDRA IRIMIE, O. HENEGARIU, A. DAMIAN, I. Ş. GROZA

A study regarding antimullerian factor’s activity in basset hound puppy males younger than 120 days

156

POPESCU SILVANA, CRISTIN BORDA, EVA ANDREA DIUGAN, DANIELA OROS, REBECCA GRATZIELLA VLAIC

Reaction to humans in tethered stallions using qualitative behavioural assessment

161

POPESCU SILVANA, CRISTIN BORDA, DANIELA OROS, EVA ANDREA DIUGAN

Veterinary records and owners perceived health problems in horses: an epidemiological study

167

STAN F. Gross anatomy of digestive system in Eastern Grey Kangaroo (Macropodidae family)

173

STANCU A., I. OLARIU-JURCA, A. OLARIU-JURCA, CLAUDIA SALA, ADRIANA MORAR, M. PENTEA, K. IMRE

Deep pectoral myopathy (green muscle disease) in a household reared and slaughtered broiler chicken – A case study

183

STANCU A., I. OLARIU-JURCA, A. OLARIU-JURCA, M. PENTEA, L. FLUERASU

The role of lymph nodes pathological lesions in assessing the evolution of respiratory PRRS syndrome

188


224

ŢIBRU I., C. LĂZĂRESCU, ELENA CAUC

Assessment of dairy cow welfare using as criterion the man-animal relationship

193

ŢIBRU I., C. LĂZĂRESCU, G. SIMION

Maintaining the optimum microclimate by ensuring the required air volume

197

ZAMBORI CSILLA, A.A. MORVAY, MIRABELA CRISTEA, E. TIRZIU, V. PĂUNESCU

Pluripotent stem cells for cardiac repair and recellularization

203

AUTHORS INDEX 219

TRADITIONAL BY BIOCHEMISTRY AND …...of Romania” from Timisoara, 300645, Aradului Street No. 119,...

Documents

Transcript of TRADITIONAL BY BIOCHEMISTRY AND …...of Romania” from Timisoara, 300645, Aradului Street No. 119,...