UNIVERSITATEA „CONSTANTIN BRÂNCOVEANU” - PITEŞTI -

CCaammeelliiaa CCHHIIRRIILLĂĂ GGeeoorrggiiaannaa MMÎÎNNDDRREECCII AAddeellaa DDUUMMIITTRREESSCCUU MMiihhaaeellaa BBUURRSSUUGGIIUU

PPPPPPPP RRRRRRRRAAAAAAAACCCCCCCC TTTTTTTT IIIIIIII CCCCCCCCAAAAAAAALLLLLLLL EEEEEEEENNNNNNNNGGGGGGGG LLLLLLLL IIIIIIII SSSSSSSSHHHHHHHH

FFFFFFFFOOOOOOOORRRRRRRR CCCCCCCCOOOOOOOOMMMMMMMMMMMMMMMMUUUUUUUUNNNNNNNN IIIIIIII CCCCCCCCAAAAAAAATTTTTTTT IIIIIIII OOOOOOOONNNNNNNN

- APPLICATIVE COURSE -

Piteşti, 2013

3

CONTENTS

INTRODUCTION...............................................................................................................5

UNIT 1 ..............................................................................................................................7 INTERVIEW WITH A BUSINESSMAN ...............................................................................7

Grammar Focus: The verbs To be and To have.......................................................11

UNIT 2 ............................................................................................................................13 A TYPICAL MANAGER’S OFFICE...................................................................................13

Grammar Focus: The Noun ....................................................................................16

UNIT 3 ............................................................................................................................19 DESCRIBING PEOPLE ...................................................................................................19

Grammar Focus:The Adjective................................................................................22

UNIT 4 ............................................................................................................................26 BUSINESS DRESS CODE ..............................................................................................26

Grammar Focus:The Pronoun................................................................................29

UNIT 5 ............................................................................................................................35 HOBBIES AND INTERESTS............................................................................................35

Grammar Focus: Present Tense Simple..................................................................39

UNIT 6 ............................................................................................................................42 PEOPLE AND WORKPLACES ........................................................................................42

Grammar Focus: Present Tense Continuous...........................................................46

UNIT 7 ............................................................................................................................49 BUSINESS MEALS & SOCIALIZING ...............................................................................49

Grammar Focus: Present Perfect Simple ................................................................52

UNIT 8 ............................................................................................................................55 STAYING IN A HOTEL ....................................................................................................55

Grammar Focus: Present Perfect Continuous..........................................................57

UNIT 9 ............................................................................................................................60 TRAVELLING..................................................................................................................60

Grammar Focus: Past Simple Tense.......................................................................63

UNIT 10 ..........................................................................................................................66 BANKING SERVICES .....................................................................................................66

Grammar Focus: Past Continous Tense..................................................................69

UNIT 11 ..........................................................................................................................71 BUSINESS COMMUNICATION .......................................................................................71

Grammar Focus: Past Perfect Simple and Continuous.............................................75

4

UNIT 12 ..........................................................................................................................79 HIGHER EDUCATION.....................................................................................................79

Grammar Focus: Future Tenses .............................................................................82

UNIT 13 ..........................................................................................................................86 THE INTERNET – A GREAT INVENTION OF MODERN TIMES.......................................86

Grammar Focus: Modal Verbs ................................................................................88

UNIT 14 ..........................................................................................................................91 MASS MEDIA..................................................................................................................91

Grammar Focus: Direct and Indirect Speech ...........................................................94

UNIT 15 ..........................................................................................................................98 ONLINE SHOPPING .......................................................................................................98

Grammar Focus: The Conditional Mood..................................................................99

UNIT 16 ........................................................................................................................103 ENTERTAINMENT ........................................................................................................103

Grammar Focus: Formal and Informal Speech ......................................................105

UNIT 17 ........................................................................................................................109 CULTURAL DIFFERENCES ..........................................................................................109

Grammar Focus: British and American English......................................................111

UNIT 18 ........................................................................................................................115 THE LIFE OF A SUPERMARKET MANAGER................................................................115

Grammar Focus: Wishes ......................................................................................117

UNIT 19 ........................................................................................................................119 BEATING THE COMPETITION......................................................................................119

Grammar Focus: The Passive Voice .....................................................................121

UNIT 20 ........................................................................................................................124 THE ENVIRONMENT– A REAL GLOBAL ISSUE ...........................................................124

Grammar Focus: Phrasal Verbs............................................................................125 LIST OF IRREGULAR VERBS.......................................................................................128 SELECTED BIBLIOGRAPHY.........................................................................................133

5

IntroduIntroduIntroduIntroductionctionctionction

The purpose of this book is to assist students in communicating The purpose of this book is to assist students in communicating The purpose of this book is to assist students in communicating The purpose of this book is to assist students in communicating

effectively in English. effectively in English. effectively in English. effectively in English. In many ways, the book looks like a general course In many ways, the book looks like a general course In many ways, the book looks like a general course In many ways, the book looks like a general course

book, but, as the title suggests, with a particular focus on communication. book, but, as the title suggests, with a particular focus on communication. book, but, as the title suggests, with a particular focus on communication. book, but, as the title suggests, with a particular focus on communication.

It gives clear practical tips per It gives clear practical tips per It gives clear practical tips per It gives clear practical tips per each topic that might be applicable to each topic that might be applicable to each topic that might be applicable to each topic that might be applicable to

their daily communication, especially in business.their daily communication, especially in business.their daily communication, especially in business.their daily communication, especially in business.

The layout of the book is very simple The layout of the book is very simple The layout of the book is very simple The layout of the book is very simple focusing on reading, focusing on reading, focusing on reading, focusing on reading,

speaking, listening, and writing skills. speaking, listening, and writing skills. speaking, listening, and writing skills. speaking, listening, and writing skills. The book is organized into twenty The book is organized into twenty The book is organized into twenty The book is organized into twenty

units where reading texts are usunits where reading texts are usunits where reading texts are usunits where reading texts are used as contexts to develop the students’ ed as contexts to develop the students’ ed as contexts to develop the students’ ed as contexts to develop the students’

communication skills. communication skills. communication skills. communication skills.

Each unit has two different sections. The first section is based on Each unit has two different sections. The first section is based on Each unit has two different sections. The first section is based on Each unit has two different sections. The first section is based on

interaction, word associations, comprehension, oral and written interaction, word associations, comprehension, oral and written interaction, word associations, comprehension, oral and written interaction, word associations, comprehension, oral and written

communication and language activities. The topics approached communication and language activities. The topics approached communication and language activities. The topics approached communication and language activities. The topics approached in the in the in the in the

book encourage students to think and communicate on the themes book encourage students to think and communicate on the themes book encourage students to think and communicate on the themes book encourage students to think and communicate on the themes

discussed. The second section focuses on grammar and it aims to help discussed. The second section focuses on grammar and it aims to help discussed. The second section focuses on grammar and it aims to help discussed. The second section focuses on grammar and it aims to help

students know the basic grammar rules and use grammatical structures students know the basic grammar rules and use grammatical structures students know the basic grammar rules and use grammatical structures students know the basic grammar rules and use grammatical structures

accurately when communicating in real language taccurately when communicating in real language taccurately when communicating in real language taccurately when communicating in real language tasks. Appendices asks. Appendices asks. Appendices asks. Appendices

include a list of irregular verbs, usage of punctuation marks, as well as a include a list of irregular verbs, usage of punctuation marks, as well as a include a list of irregular verbs, usage of punctuation marks, as well as a include a list of irregular verbs, usage of punctuation marks, as well as a

selected vocabulary list of measurement.selected vocabulary list of measurement.selected vocabulary list of measurement.selected vocabulary list of measurement.

This book is primarily a learnerThis book is primarily a learnerThis book is primarily a learnerThis book is primarily a learner----centered and taskcentered and taskcentered and taskcentered and task----based course based course based course based course

book. It reflects some of the approaches in English languabook. It reflects some of the approaches in English languabook. It reflects some of the approaches in English languabook. It reflects some of the approaches in English language teaching ge teaching ge teaching ge teaching

and learning currently in practice around the world. Overall, the book and learning currently in practice around the world. Overall, the book and learning currently in practice around the world. Overall, the book and learning currently in practice around the world. Overall, the book

6

provides students with an interesting and practical tool for intensifying provides students with an interesting and practical tool for intensifying provides students with an interesting and practical tool for intensifying provides students with an interesting and practical tool for intensifying

communication in the English language while studying and practising communication in the English language while studying and practising communication in the English language while studying and practising communication in the English language while studying and practising

grammar. We believe students wigrammar. We believe students wigrammar. We believe students wigrammar. We believe students will find this book a refreshing change and ll find this book a refreshing change and ll find this book a refreshing change and ll find this book a refreshing change and

we advise them to keep it we advise them to keep it we advise them to keep it we advise them to keep it on the work desk for an easy reach when needed.on the work desk for an easy reach when needed.on the work desk for an easy reach when needed.on the work desk for an easy reach when needed.

The authorsThe authorsThe authorsThe authors

7

UnitUnitUnitUnit 1 1 1 1

IINNTTEERRVVIIEEWW WWIITTHH AA BBUUSSIINNEESSSSMMAANN

Born and raised in Belgium, James Brooks is a former Australian manager who has

lived and worked on many continents. With his parents and his wife’s continuous support, he managed to become a successful businessman. Recently his parents-in-law have become his business partners. Today James Brooks runs multiple businesses in different countries. Here’s an interview offered by James Brooks to a business magazine.

Journalist: “You are a famous businessman and your life is permanently associated with businesses. What is the story of your life?”

James Brooks: “Well, I was born in Antwerp, Belgium. I graduated the University of Antwerp, getting a degree in business studies. When I was almost 20, I started my career working for Morris Industries in Melbourne, Australia, which I consider to be the chance of my life. My aunt was the company’s executive and she helped me get some business experience. In time, I became her manager. After ten years I recreated my career and I started my own business.”

Journalist: “How did you handle both your studies and your job?” James Brooks: ”It was very difficult at first. I had to fly to Belgium every month to attend

classes at the university. I had to study for my exams, to improve my fluency in English and to learn German. It was a big effort but finally I was successful. And I met a beautiful flight attendant, who is my wife now. Together we have a daughter, Cathy, who is 12, and a son, Benjamin, who is 8.”

Journalist: “How important were foreign languages in your career?” James Brooks: “They were vital. I couldn’t have succeeded without speaking some

foreign languages. I have businesses all over the world. I must keep in touch with my people. I need to speak their language or any other language they understand. Now I speak Dutch, French, English, German and some Italian.”

Journalist: “By the way, what determined you to run multiple businesses?” James Brooks: “You see there are some advantages when you choose to follow this

direction. First of all, a greater variety of tasks makes you better and better in your work. Then, you diversify your income sources which can offer a greater financial security. Today I invest my money in education, research, financial management and real estate.”

Journalist: “Except talent, experience and ambition, what else do people need to be successful in business?”

James Brooks: “They must be lucky!” Journalist: “Are you a happy person now?” James Brooks: “I’ve always been happy. I have my family and my friends next to me all

the time. You don’t have to be a millionaire or a magnate to be happy. Nevertheless, a large budget probably makes it easier!”

Journalist: “Thank you for your time.” James Brooks: “You’re welcome!”

8

Vocabulary Focus

former – having been such at some previous time

support – an act or instance of helping

parent-in-law – a person who has a legal affinity with another by being the parent of the other's spouse

flight attendant – member of an aircrew employed to ensure the safety and comfort of passengers

fluency – ability to express oneself readily and without effort

to keep in touch – to maintain communications with someone

to run a business – to control, manage, or direct

research – to study about something thoroughly

executive – a person or group having administrative or managerial authority in an organization

real estate – land, including all the natural resources and permanent buildings on it

to handle – to deal with or have responsibility for

magnate – a powerful or influential person, especially in business or industry

•

Vocabulary Practice

1. Match the countries on the left with the nationalities on the right: 1. Romania a. Spanish 2. France b. Portuguese 3. The United States of America c. German 4. China d. Dutch 5. Japan e. English 6. Turkey f. Romanian 7. Portugal g. Russian 8. Holland h. Turkish 9. Denmark i. Chinese 10. Italy j. American 11. Spain k. Japanese 12. England l. French 13. Germany m. Hungarian 14. Russia n. Danish 15. Hungary o. Italian

Now discover the country or the nationality in the following sentences: 1. There are thermal baths all over this country, including in the capital, Budapest. 2. They like drinking vodka. 3. Its capital city is Ankara. 4. Dracula lived on the territory of this country. 5. They grow tulips and have windmills.

9

6. Country where people eat paella and watch corridas. 7. Its largest city is Berlin. 8. George Bush was their former president. 9. Their capital city is Paris. 10. They eat spaghetti and pizza. 11. This Asian country has the most popular wall in the world. 12. They love talking about the weather and their queen. 13. This is a Northern European country where the Vikings lived for some time. 14. Asian people who are very good at making electronic equipments. 15. Situated in Southern Europe, this country shares the Iberian Peninsula with Spain.

2. Translate the following sentences into English: 1. Fiica mea lucrează în Spania. Noua ei casă este în Malaga, pe coasta de nord a

Mării Mediterane. 2. Noi locuim în Danemarca. PărinŃii şi bunicii noştri locuiesc în Olanda. 3. Ştiu că Steve este la Moscova acum. El începe o afacere cu partenerii ruşi. 4. Marcello este din Italia, însă soŃia lui este din Germania. Ea a locuit la Frankfurt

înainte să se căsătorească. 5. Karen şi Andy sunt studenŃi britanici. Ei studiază la Londra. 6. Ştii că fratele şi cumnata lui s-au mutat în FranŃa? Ei au cetăŃenie franceză acum.

3. Read the text. Are the sentences true or false? Hi! My name is Blanca and I’m from Madrid, Spain. I am a student at the Technical University of Madrid. My boyfriend, Juan, is also Spanish. He is a shop assistant. The shop is in the centre of Madrid. Juan is from Barcelona. We aren’t married. I’m 24 and Juan is 26. My address is 10 San Antonio, Madrid, and my telephone number is 91 523 487.

TRUE FALSE 1. Madrid is in Italy. 2. Blanca’s from Madrid. 3. Juan is not from Madrid. 4. Blanca is a shop assistant. 5. Juan is a shop assistant. 6. Juan’s 26. 7. Blanca’s 26. 8. The shop is in Barcelona. 9. Juan and Blanca are not married. 10. Juan’s address is 10 San Antonio, Madrid.

4. Choose the correct reply (a or b) to each of the sentences (1-7):

1. Nice to meet you. a. Hello! b. Fine, thanks.

2. How was your flight? a. That would be nice. b. Very good, thanks.

10

3. I’ll take you to your hotel and then we can have dinner there.

a. Fine, thanks. b. Thank you. That would be nice.

4. How are you? a. Very well, thanks. b. Nice to meet you.

5. It was nice meeting you! a. Pleased to meet you. b. Nice meeting you too.

6. I look forward to seeing you next time. a. Yes, me too. b. Here you are.

7. Have a good trip back! a. Thanks. b. You are welcome.

5. Complete the telephone conversation. Use the right greetings and formulas: A: “This is Morel’s Restaurant.” B: “…… . This is Chris Alvarez.” A: “Good morning, Mr. Alvarez. Can I help you?” B: “Yes, ….. . I would like a table for two.” A: “Certainly. When are you coming?” B: “Tonight. It’s my birthday today.” A: “Oh, …… !” B: “Thank you.” A: “What time would you like to make the reservation?” B: “8.00.” A: “Ok, Mr. Alvarez. We’ll see you at 8.00 tonight.” B: “. …… . Goodbye!” A: “……“

6. Fill in the blanks with the adequate expression: father-in-law, daughter, parents, uncle, children, married to, aunt, granddaughter, husband, cousins.

My best friend, Scott, is 33 years old. He is …… Helen who is 31 years old. They are …..

and wife. They have a ……, Lisa, and a son, Henry. The family lives next to Helen's parents, Ben and Doris. Ben is Helen's father and Doris

is her mother. Ben is Jack's …… and Doris is his mother-in-law. Henry is their grandson and Lisa is their …… . Henry and Lisa say that they have the best grandparents in the world.

Helen also has a sister and a brother. Her sister's name is Mary and her brother's name is Frank. Frank has two ……, David and Sherrie. The kids are Henry and Lisa’s …… . Sherrie is Helen's niece and David is Helen’s nephew. Helen is their ….. and Scott is their …… .

Scott’s ….. live in the country. The kids love to spend their holidays with them. They also have a dog, Spot, and a cat, Whiskers. They are good friends with the pets.

7. Fill in the blanks with the right terms denoting family members:

1. Your husband’s parents are your …. . 2. Your sister’s daughter is your …. . 3. Your uncle’s children are your …. . 4. His son’s children are his …. .

11

5. My daughter’s daughter is my …. . 6. His wife’s sister is his …. . 7. My husband’s sister is my …… 8. Their children’s children are their …..

GRAMMAR FOCUS

TO BE / TO HAVE

Affirmative Negative Interrogative

TO BE

I am (I’m) You are (You’re) He/She/It is (He’s) We/You/They are

I am not You are not He/She/It is not We/You/They are not

Am I? Are you? Is he/she/it? Are we/you/they?

TO HAVE

I/You have He/She/It has We/You/They have

I/You have not (haven’t) He/She/It has not (hasn’t) We/You/They have not

Have I/you? Has he/she/it? Have we/you/they?

Examples:

Alison is my colleague at the university. She is not my best friend. Are you his new manager?

We have a new car. I have not a good job. Has he a Romanian-English dictionary?

GRAMMAR PRACTICE

8. Fill in the blanks with the right form of the verb to be: 1. It ….. cold today. 2. I ….. at home with my family. 3. These people ….. Korean. 4. There ….. a pen on the desk. 5. My name ….. Nikita. 6. We ….. from Ukraine. 7. Those ladies ….. my colleagues. 8. I ….. OK, thanks. 9. Clara and Steve ….. married. 10. She ….. our English teacher. 11. This girl’s birthday ….. in April. 12. The Germans ….. very civilized.

12

9. Fill in the blanks with the right form of the verb to have: 1. We ….. many relatives in our family. 2. Jane ….. five English books. 3. I ….. an expensive sport car. 4. Doris …. two cousins in Australia. 5. They ….. a big house not far from the beach. 6. My sister ….. a lot of books in her room. 7. My father ….. a new computer in his office. 8. My mother ….. a sister and a brother. 9. Jack ….. some uncles in Iraq. 10. Bill Gates ….. a lot of money. 11. She ….. a baby daughter and an older son. 12. They ….. four tickets to the show.

10. Underline the correct verbal form: 1. We are / have a new colleague. 2. I am / have a lot of money. 3. She is / has a good wife for a rich husband. 4. You are / have our best friends. 5. They are / have a lot of work to do. 6. Her friend is / has an expensive watch. 7. You are / have a large family. 8. My brother-in-law is / has a good economist. 9. Their children are / have a nice and clean room. 10. The English textbook is / has 10 units.

11. Translate the following sentences into English: a. Prietenul meu este student la această universitate. b. El are 2 fraŃi şi 2 cumnate în Norvegia. c. Cele 3 mătuşi ale ei sunt în Spania împreună cu familiile lor. d. Colegii noştri sunt în sala de seminar. e. El este nepotul unui mare politician. f. Este colegul tău un bun student? g. Italienii şi nemŃii nu au familii numeroase. h. Benjamin este din Anglia, Helen este din SUA, iar Michelle este din FranŃa. i. Socrii mei nu sunt la New York, ei sunt la Londra. WRITING FOCUS

12. a. Make a short description of your family. Write about 150-200 words. b. Write an essay in which you highlight the greeting differences of various nationalities. SPEAKING FOCUS

13. a. A possible business partner comes to your office. Make a conversation in which you introduce yourself to the visitor.

b. Discuss the importance of speaking more foreign languages.

13

Unit 2 Unit 2 Unit 2 Unit 2

AA TTYYPPIICCAALL MMAANNAAGGEERR’’SS OOFFFFIICCEE

Charles Campbell has just graduated university and is now thinking seriously about

opening his own business. But, based on his professional training, knowledge and information, he knows very well that he has to consider a business plan; so he is going to start by organizing his office. He knows there will be plenty of important decisions to make and that is why he has set out some criteria to keep in mind: location, available financing, office equipment and office furniture. 21st century technology has greatly advanced and that is why a modern office uses a large and varied amount of equipment for efficient daily activities.

Charles Campbell wants to begin with his office furniture which must include a computer desk and at least two chairs, an armchair and a sofa, a nice floor carpet to match the light-coloured office walls and curtains or window blinds, some wooden office shelves and file cabinets for storing stacks of paper and important documents, air conditioner and some colourful flower vases. Charles is also thinking about a whiteboard and marker pens, but his budget cannot cover them yet. On his office desk he will need a desk lamp, a multi-line telephone system to ensure efficient communication, including a fax machine and a voice recorder, a computer or a laptop with a multifunctional printer (including a photocopier and a scanner), an electronic typewriter, a paper shredder, and possibly a multimedia projector.

Next, the future manager must purchase office stationery and mailing supplies, such as: pens, pencils, rulers, stapler and staples, paperclips, notepads to record minutes in meetings, post-it notes for short messages, calculator, business cards, writing paper, paper bags, envelops and stamps, a pair of scissors, folders, notebooks, correction instruments and other items.

Charles knows he will be very busy in the near future searching for the best deals and finding someone reliable to help him purchase all these office equipment items to start a successful business, but he is also aware of the benefits of investing in and using modern equipment: saving money, saving time and saving the environment.

Vocabulary Focus

criterion, (pl.) criteria – a standard or a rule by which something can be judged or decided

paper shredder – a mechanical device used to cut paper into chad, typically either strips or fine particles

carpet – a thick heavy covering for a floor, usually made of woven wool or synthetic fibres; a rug

stationery – office materials (such as paper, pens, ink, etc.) used for writing or typing

available – present and ready for use; at hand; accessible

supplies – materials or provisions stored and dispensed when needed

14

window blinds – a blind for privacy or to keep out light

stapler – a mechanical device that joins sheets of paper or similar material by driving a thin metal staple through the sheets and folding the ends

shelf, (pl.) shelves – a structure made of a rigid material, fixed on a wall and used to hold or store objects

staple – a small formed metal fastener

file cabinet – office furniture consisting of a container for keeping papers in order

paperclip – a clip for holding paper sheets together, especially one made of bent wire

to store – to reserve or put away for future use

minutes (pl.) – an official record of the proceedings of a meeting

stack – an ordered pile, especially arranged in layers

reliable – capable of being relied on; dependable

to purchase – to obtain in exchange for money or its equivalent; to buy

Vocabulary Practice

1. Find out the correct words by rearranging the letters. Start with the Capital letter:

a) t l e S a p f) p l e r S t a b.) h e f l S g) u r n i F t e r u c) n q E i p u m t e h) f e c O f i d) d e r F o l i) r a n a g M e e) b o t e N o k o j) S r s i s c o s

2. Cross out the odd word from each series: a. to purchase, to buy, to pay for, to sell, to obtain, to acquire; b. pen, pencil, ruler, minutes, stapler, paperclips; c. available, vacant, existing, accessible, obtainable, unavailable; d. office, department, place of work, bureau, headquarters, workplace; e. pencil, curtains, carpet, window blinds, sofa, chair; f. honest, trustworthy, undependable, reliable, responsible, dependable.

3. Fill in the sentences with the following words:

kitchen, windows, ceiling, ranch house, night table, garden, porch, carpet, walls, bed

a. We live in a …………………. in the country-side and in front it has a large flower ………………. and an orchard in the back.

b. In our house there are a lot of modern paintings on the …………………. c. My bedroom has large ………….. with blue blinds, a king-size …………. with a small

……………. next to it and some mirrors.

15

d. In the living room there is an expensive original Persian …………. on the floor and a chandelier hanging from the ……………….

e. We cook our meals in the ……………, but we eat in the dining room or on the ………… when there is nice weather outside.

4. Find the appropriate word for each of the following definitions (use a dictionary).

a. A room where people can cook or prepare dinner is called a ………. . b. A piece of furniture where people keep their clothes is called a ……………………. . c. A room where people can take a bath or a shower is called a …………… . d. A piece of furniture on which people can sit, relax, watch TV or read is called a …… . e. A big lamp hanging from the ceiling is called a …………… . f. A room below the roof of a house usually used for storing different items is called an

……………….. . g. A small room, usually off a kitchen, used for the storage of food provisions,

tableware, etc. is called a ………………. . h. The area below the ground floor where people store various things is called a

……………….. . i. A room in a house designed for the use of children is called a …………………… . j. A room or a space used especially for storing wines is called a ………………….. .

5. Answer the following questions. a. What does a manager have to consider before starting a business and why? b. What type of furniture and equipment can you find in a typical manager’s office? c. Think of other important examples of office equipment and furniture that a

manager’s office should have, other than the ones mentioned in the text. d. Think of ways in which the most important items of office equipment mentioned in

the text could be used. e. Which are the benefits of a modern and fully-equipped office? f. Talk about the furniture you have at home.

GRAMMAR FOCUS

THE ARTICLE

Type Form Uses Examples It points out a particular individual, group or class, or a definite concept/notion.

The coffee you make is delicious.

For surnames in the plural. The Smiths live in London.

Definite article

THE – pronounced [ðə]: the boy and [ði]: the apple

For names of countries in the plural, mountains ranges, regions.

The United States of America; The Netherlands; The Alps; The Middle East

16

Type Form Uses Examples

For names of oceans, seas, rivers.

The Atlantic (Ocean); The Nile; The Statue of Liberty

For months, days of the week, etc. (definite).

The August of 2010 was the hottest.

For unique nouns. The Earth; The Sun; The White House

With musical instruments. She plays the piano.

To define a class of people (using an adjective).

the rich; the poor; the British

To talk about something in general.

Coffee is a popular drink.

For names of people. Peter and Charles live in London.

For names of countries in the singular; summits of mountains, towns, countries.

Romania; Mount Everest; Europe; New York

For months, days of the week, etc. (indefinite).

Let’s meet on Monday. August is my favourite month.

No article —

For names of parks, lakes, streets.

Central Park; 42nd street; Oxford street; Loch Ness

It refers to any one of a group or class of things. It can only be used with countable nouns in the singular.

You can drink a glass of milk in the kitchen.

Before phrases of time and measurements.

We study English once a week. The bananas are 1€ a kilo.

Before of phrases of jobs. He is a manager.

A – a boy; An – an apple

Before nationality adjectives. Obama is an American president.

Indefinite article

Some It is used with countable nouns in the plural and with uncountable nouns.

I’d love to have some milk. He gave me some information/ advice/news on this issue.

THE NOUN

Singular Plural

COUNTABLE NOUNS – Regular plural

Noun + s a room / an office two rooms / offices Noun + es (after sibilants) a porch / a suitcase two porches / suitcases Noun ending in y changes it into i + es after consonants

a city / a party / a lady two cities / parties / ladies

Noun ending in y keeps it a toy / a day two toys / boys

17

Singular Plural

in the plural after a vowel Noun ending in f or fe a) changes it into v + es in the plural b) keeps the f in the plural

a wife / a shelf a roof / a cliff

two wives / shelves two roofs / cliffs

Noun ending in o a) adds s in the plural b) adds es in the plural

a photo / a disco / a piano / a studio a potato / a hero

two photos/ discos/pianos/ studios two potatoes / heroes

Nouns with two plural forms (always use a dictionary if you are not sure)

penny tornado buffalo

pennies (coins) / pence (price) tornados / tornadoes buffalos / buffaloes

COUNTABLE NOUNS – Irregular plural

a man/woman/child/mouse/ tooth/goose/foot/ox/ person/ louse

two men/ women/ children/ mice/teeth/geese/feet/ oxen/people/lice

Nouns with the same form a fish / sheep / species / means / series

two fish/ sheep/ species/ means/ series

Nouns with foreign plural a criterion / basis / crises / datum / medium

two criteria / bases / crises / data / media/mediums

UNCOUNTABLE NOUNS Nouns with no plural – they take the verb in the singular (abstract nouns)

furniture/homework/advice/ information/knowledge/ news/ luggage wisdom/intelligence/ beauty/ gold/oil

two pieces of furniture/ homework/advice/information/knowledge /news/luggage

Nouns with no singular – they take the verb in the plural

a / one pair of scissors/ trousers/glasses/ jeans/ pants

scissors / trousers / glasses / jeans / pants savings / customs / goods

COMPOUND NOUNS a son-in-law/a passer-by/ court martial a gentleman/policeman/

two sons-in-law/passers-by/courts martial two gentlemen/policemen/

GRAMMAR PRACTICE

6. Choose the right form (pay attention to nouns and articles): a. There is/are an/some interesting news on TV about office equipment/equipments. b. Money are/is very important when you decide how much you can spend on new

furniture/furnitures. c. Is/are there much/many traffic in London at rush hours? d. My boss has an/the appointment with a sales agent to get some/an information about

some low price studios/studioes. e. I work as an/the accountant and I think I need a/the new pair of glass/glasses.

7. Fill in the blanks with the appropriate plural form of the nouns in brackets: a. Our managers are real (gentleman) ………………….. . b. You can buy two (furniture) …………………… at the price of one for your office.

18

c. In business you must listen to as many (advice) ………………….. as possible to make the right decision.

d. The policy of this airline company is to board (woman) ………………… and (child) ………………. first on the plane.

e. I visited three (city) …………….. in two (day) …………….., I took many (photo) ……………. and I sent three (postcard) …………… .

f. In our new office we must purchase two (armchair) ………………., four (shelf) ………………, two (fax) ……………… and two (paper shredder) …………………… .

8. Correct the mistakes in the following sentences (there is one mistake in each sentence): a. I need an advice on how to order some office equipment online. b. They urgently need some informations about accommodation in London. c. I am very sorry I am late, but the traffic were very busy. d. The news are on TV right now. e. He has a lot of luggages for a two-day trip. f. We live in Netherlands with our family. g. He works as assistant manager in a famous company. h. We have many knowledge on this matter. i. My neighbour talks to two mans everyday. j. My glasses is not in my pocket.

9. Translate the following sentences into English: a. Aceste criterii sunt foarte utile în activitatea noastră. b. Noi trebuie să achiziŃionăm câteva rafturi şi jaluzele pentru noul nostru birou. c. Aceste femei şi aceşti bărbaŃi au multe articole de papetărie moderne. d. Pe birou sunt nişte agrafe, dar nu ştiu unde este capsatorul. e. Cei doi poliŃişti deŃin multe date, informaŃii şi noutăŃi despre aceste persoane. f. Tatăl ei este o persoană onestă şi lucrează ca pilot de avion. g. Copiii noştri vor vizita muntele Everest şi Loch Ness la vară. h. Vecina mea cântă la pian şi la vioară. i. Eu ascult mereu radioul dimineaŃa şi seara. j. În India săracii şi bogaŃii trăiesc în lumi diferite.

WRITING FOCUS

10. Describe the place where you live (house, flat, studio) or the place where you would like to live. Mention the rooms, the furniture and the electric appliances that you have in your house.

SPEAKING FOCUS

11. Talk about the way you would like to furnish and equip your office to be successful in your business. Motivate your choices.

19

Unit 3 Unit 3 Unit 3 Unit 3

DDEESSCCRRIIBBIINNGG PPEEOOPPLLEE

“Kate, let’s get going. We’re going to be late for the party!” “Just a second, Kevin, I’m coming; if only I could find my tiny old round pink-diamond

golden ring to match my brand-new dress . . . I don’t want to miss any minute of this awesome get-to-know-each other-party thrown by our boss. Oh, finally, here it is! I’m ready.”

“Kate, you look breath-taking, all our new work colleagues will be impressed. Let’s go, the cab is waiting downstairs.”

After twenty minutes, at the party. “Kevin, this place is great; it looks very bright, luxurious and large. The light beige

walls match the golden curtains so well, and the lights …. Everything is shiny and the atmosphere is fantastic. Look at the band, the musicians are performing amazingly, though the music is not too loud. There are so many people here; you’ll have to tell me a little bit about everybody. Who’s that good-looking, well-dressed, young, slim lady over there?”

“Which one, exactly? There are too many people here.” “The one next to the blue table, the tall, red-haired, beautiful one, I think she has

freckles and light complexion.” “Oh, I see her now. She is our boss’s wife. Her name is Brigitte Johnson.” “She is very beautiful. What’s she like?” “She is extremely intelligent and confident, but she’s also outgoing and funny.

Nevertheless, at work she is fairly demanding and a perfectionist sometimes.” “Is her husband here? What does he look like?” “Of course he’s here, he threw this party. Look, he’s moving towards Brigitte. He’s

three years older than his wife. He’s the tall, middle-aged man over there. He’s got a beard and a thick moustache and he wears glasses. He’s oval-faced, he’s got green eyes and dark blonde short hair, crew-cut. He looks very smart now, but usually he dresses quite casually at work.”

“Now I see him too. He seems very friendly and sociable.” “Yes, he is. Look, they are coming this way; let’s say ‘Hello’ to them.” “Hello, Mr Johnson, let me introduce my fiancée, Kate.” “It is a pleasure to meet you, Kate. This is my wife, Brigitte.” “This is an amazing party; everybody is dancing and having a great time. This is the

best way to get to know a little bit better our work colleagues. Mr Johnson, you had an excellent idea with this party. Let’s mingle and enjoy it!” Vocabulary Focus

to match – to be exactly like, to correspond exactly

nevertheless – in spite of that, however, nonetheless

20

brand-new – absolutely new demanding – requiring much effort or attention, or great patience or skill

breath-taking – inspiring or exciting, astonishing

middle-aged – relating to a person’s life between youth and old age (45-65 years old)

though – despite the fact that, although

beard – the hair on a man’s chin, cheeks and throat

confident – marked by confidence in oneself, self-assured

to mingle – to join or take part with others, to mix, to bring together, to merge

outgoing – sociable and responsive to others, friendly

complexion – the natural colour, texture and appearance of the skin, especially of the face

Vocabulary Practice 1. Match the following headings with the right columns of describing adjectives.

a. Personality b. Height c. Face d. General appearance e. Complexion f. Build g. Hair h. Age

Young Old Elderly Middle-aged In his/her 30s

Beautiful (women) Pretty (girls) Handsome (men) Cute Good-looking Attractive Scruffy Untidy-looking Messy-looking

Short Long Medium length Bald Straight Wavy Curly A ponytail White Grey Blond/fair-haired Light or dark brown Red Black

Outgoing Sociable Friendly Smart Reliable Shy Lazy Perfectionist Good sense of humour Immature Childish Talkative Generous

Short/shortish Tall/tallish Average height

Square Round Oval Thin Wide Thin or round-faced With freckles/freckled With wrinkles/ wrinkled Chubby Tanned

Average built Slim (positive) Overweight (positive) Well-built/muscular (positive) Plump (neuter) Stocky (neuter) Skinny (negative) Fat (negative)

Light White Olive-skinned Dark/light-skinned

21

2. Complete the gaps with the appropriate missing words. Use the explanations in brackets to help you.

a. “What does this Asian woman look like?” “Well, she’s …………-faced, ……………..-haired, …………-eyed, she is of …………… height and she is very …………, in her early 20s.” “And what is she like?” “She is very ……………… (likes people) and highly …………….. (she has a 150 IQ).”

b. “Could you describe this African-American person a little bit for me, please?” “Of course, he is very ………. (1.95m.), he is ………….-skinned, his hair is …………… and of medium ………………., he has big …………… eyes and he wears sun-…………… all the time.” “And what about his personality, what’s he like?” “Well, he is not very …………………. (he does not talk much) and he is not very ……………… (he does not socialize much) because he loves computers; but he is very …………………. (smart person) and …………………. (you can count on him).”

3. Find the opposite for the following descriptions. Use the example as a model. Example: I think his brother is rather tall, tanned and stocky.

No, quite the opposite; he is shortish, he has a light complexion and he is slim.

a. I think her mother is average height, she has long curly dark hair and she is olive-skinned.

No, quite the opposite; ………………………………………….. b. I think her husband is short, well-built, in his 30s, he has a long beard and a

chubby face. Oh, no; ……………………………………………………………. c. She says your boss is tallish, grey-haired, in his 50s, he wears glasses and has a

thick moustache. No, ……………………………………………………………... d. He has a wide face and dark complexion, and he is very muscular. Oh, no ………………………………………………………….. e. She is around 20, tall, slim, beautiful and has long straight black hair. On the contrary, ……………………………………………………

4. Answer the following questions about the text. a. Why is Kate late for the party? b. How is the location of the party? How do Kate and Kevin describe it? c. How does Brigitte Johnson look like? How about her personality, what is she like? d. How does Kevin’s boss look like? What is he like? e. How are their work colleagues dressed at the party? f. How do you think people should dress at a party?

GRAMMAR FOCUS

22

THE ADJECTIVE The adjective is a part of speech that qualifies a noun or a noun phrase, giving more

information about it, and it directly precedes the noun or nominal phrase: She is a beautiful lady. This is a very fast train. We drink fresh hot milk every night. Order of adjectives. In English, if there are more than two adjectives that qualify a noun,

there are some guidelines for arranging them in a sentence.

Qua

ntity

/Num

ber

Opi

nion

/Qua

lity

Siz

e/ D

imen

sio

n/

Ap

pea

ran

ce/

Mea

sure

/ S

hap

e/ C

on

dit

ion

Age

Shap

e

Col

our

Prop

er a

djec

tive/

Orig

in

Mat

eria

l

Purp

ose

Nou

n

One useful big new oval red and white

English cotton sleeping bag

Degrees of comparison

Comparative degree Superlative degree Type

of adj. Positive degree Of superiority Of equality

Of inferiority

Relative superlative

Absolute superlative

Shor

t Ad

ject

ives

Tall Nice Happy Easy Big Thin

Adj.+er than Taller than Nicer than Happier than Easier than Bigger than Thinner than

As+adj.+ as As tall as As nice as

Not as+adj.+as Not as tall as Not as nice as

The+adj.+ est The tallest The nicest The happiest The easiest The biggest The thinnest

Adverb+adj Very / Extremely / Perfectly / Really / Highly / Remarkably tall/nice/ happy/easy, etc.

Long

Ad

ject

ives

Beautiful Handsome Intelligent Difficult Interesting

More+adj.+ than More beautiful/ handsome/ intelligent… than

As+adj.+ as As beautiful/ handsome/ intelligent…as

Not as+adj.+as Not as beautiful/ handsome / intelligent … as

The most/the least+adj. The most/the least beautiful/ handsome/ intelligent …

Adverb+adj Very / Extremely / Perfectly / Really / Highly / Remarkably beautiful/ handsome/ intelligent, etc.

23

Comparative degree Superlative degree Type

of adj. Positive degree Of superiority Of equality

Of inferiority

Relative superlative

Absolute superlative

Irreg

ular

Adj

ectiv

es Good

Bad Little Much / many Far Late Old Near

Better than Worse than Less than More than Farther/ Further than Later/ Latter than Older/ Elder than Nearer than

As+adj.+as As good as As bad as As little as

Not as+adj.+as Not as good as Not as bad as Not as little as

The best The worst The least The most The farthest/ the furthest The last/ the latest The oldest/ the eldest The nearest/ the next

Adverb+adj Very / Extremely / Perfectly / Really / Highly / Remarkably good, bad, little

Double comparatives

1. The + Comparative of adjective/adverb + S + V, the + Comparative of adjective/adverb + S + V Examples: The more you learn, the more you know. The sooner you come, the earlier/quicker we finish. The more difficult the tasks, the more rewarding the prize.

2. S + V + comparative of adjective + and + comparative of adjective Examples: It gets darker and darker in here. The party is getting better and better. This movie is becoming more and more frightening.

GRAMMAR PRACTICE 5. Arrange the following adjectives in the right order to form sentences, using the

table below:

Qua

ntity

/ Nu

mbe

r

Opi

nion

/ Q

ualit

y

Size

/ D

imen

sion

/

Age

Shap

e

Colo

ur

Prop

er

adje

ctiv

e/

Orig

in

Mat

eria

l

Purp

ose

Nou

n

a. pink / big / box / Chinese / a / brand-new. b. blue-eyed / gorgeous / blond-haired / a / girl. c. wooden / dark / a / table / small / Spanish. d. luxurious / modern / huge / a / light-brown / restaurant / room. e. teacher / American / new / handsome / student / young / good-looking f. small / nice / brown / French / old / brick and wood / ranch house.

6. Use the adjectives in brackets in the correct form of either comparative or superlative degrees of comparison.

24

a. Our university offers ………………… (good) degree courses. b. Violet is 35 years old and Tom is 50 years old; Violet is 6 years ……………..

(young) than Tom. c. My fiancée was ………………. (good-looking) girl at the party. d. The Vatican city is the ……………… (small) country in the world. e. After seeing the final results the coach decided that John is ………………… (bad)

player in the team. f. My brother is a …………………… (strong) swimmer than I am, but I’m trying to do

my best. g. When winter comes, the days are getting …………………… (cold), but also

……………. (short). h. Carol is …………………. (happy) girl today because she got good marks in school. i. Which of these two shirts is …………….. (cheap), this or that? j. Milk is said to be ………………… (healthy) and ……………… (nourishing) than

many other types of food.

7. Choose the correct form for the following double comparatives: a. The hard/harder he works, the good/better results he has. b. The less/little food he ate, the thin/thinner he got. c. Nowadays students know that the more/much they study, the best/better results

they obtain. d. The bright/brighter the sun, the happy/happier I feel. e. There are more and much/more and more tourists in certain areas of our country. f. You have to be very careful; this movie is getting more and more/less and less

complicated and sad and sadder/sadder and sadder. g. Of course you can come to the party. The much/more we are, the funnier/funniest it

will be. h. Your mother will be very upset about the failed exam. The soon/sooner you tell her

about it, the safe/safer it will be for you.

8. Translate the following sentences into English: a. Această tânără şi frumoasă domnişoară este mai înaltă şi mai bronzată decât sora mea. b. Dacă vrei să ai succes la petrecere, trebuie să fii foarte bine îmbrăcat, foarte prietenos şi natural. c. Cu cât petreci mai mult timp în faŃa televizorului, cu atât eşti mai obosit. d. Acest bărbat are barba mai lungă decât tatăl meu şi este mai scund decât el. e. Tu citeşti mai multe cărŃi decât mine, dar sora mea citeşte cele mai multe cărŃi. f. Cu cât pierzi mai mult timp în faŃa oglinzii, cu atât mai mult vei întârzia la petrecere. g. El este mai tânăr, mai inteligent, mai rapid şi mai puternic decât colegii lui de echipă. h. Şeful nostru este extrem de exigent, dar este mult mai înŃelegător decât fostul tău şef. i. Ea are ochii verzi precum şi cel mai lung şi mai cârlionŃat păr dintre toate fetele pe care le cunosc. j. Muzica este din ce în ce mai tare, iar eu sunt tot mai nerăbdător să merg acasă.

WRITING FOCUS

25

9. Write a brief article describing the physical qualities (appearance) and the personality-related aspects you are looking for in a partner. Our magazine will offer the winner a romantic dinner with the matching partner, with his/her consent.

SPEAKING FOCUS

10. Choose one of these topics: a. Describe one (or more) of the following people, giving details about their appearance (face, hair, height, build) and personality: you yourself / your best friend / your ideal of a handsome man or a beautiful woman / a relative / a neighbour. b. Make a dialogue with your partner in which you choose a person to describe: one of you should ask questions about physical appearance and personality, and the other one should answer them. c. Think about a famous person and describe him/her without giving his/her name. At the end, ask your colleagues to guess who was the person described.

26

Unit 4Unit 4Unit 4Unit 4

BBUUSSIINNEESSSS DDRREESSSS CCOODDEE

Choosing your outfit for a day at work, for a job interview, for a business lunch or for a

similar event when you want to make the best impression can be troublesome and give you a lot of headaches when checking your wardrobe, but if you are aware and if you follow certain dress codes you can simplify things dramatically.

In the business world nowadays there are a lot of written and mostly unwritten rules concerning the dress code that must be followed both by employers and by employees. In business, people usually work in an office and in order to be efficient at what they are doing they must work comfortably in their workplace. But this does not mean neglecting the way they dress since they have to project a professional image for their customers or potential partners. That is why there are some standards for the dress code.

It is obvious that casual clothing or clothing that one wears to the beach, to dance clubs, to parties, to gym sessions or the like, is not appropriate to wear to work. The appropriate business attire requires that clothing should always be pressed and never wrinkled, it should never be dirty or frayed and all seams must be finished. Companies also encourage wearing clothes with the company logo or in the company’s colours, as a way of promoting the company’s image, instead of clothes with pictures or words that might be either offensive or unacceptable.

It goes without saying that different societies and cultures have different business dress codes, but the standard in the field refers to both men and women wearing a suit, a jacket, and pants or a dress skirt. Of course this is a very simplified approach since there is also the aspect of colours – the standard being that of black and white, but shades of dark grey, blue, brown and other earth tones can never go wrong. Always stay away from bright colours since they attract attention in an unnecessary way. Women have more options and a wider range of choices to combine and create an appropriate professional attire.

The most conservative type of business wear refers to a business suit or pants suit, or dress and jacket for women (short or long-sleeved, according to the season) and a business suit or a blazer, dress pants and a tie for men. For a more relaxed business style, women can choose a casual look: a shirt with a collar and/or a sweater, dress pants, or moderate-length (knee-length) skirt or dress and a pair of nice shoes-either moderate heels or flats (avoid open-toe shoes or strapless shoes that expose your feet); men can opt for a polo shirt, a shirt with a collar and/or a sweater, dress pants and dress shoes, no tie required.

In terms of revealing clothing, it should be avoided. In case you have tattoos or body art, it should be covered. For women, jewellery, make-up, hair and perfume should never be ostentatious, but conservative and tasteful, since everything that stands out distracts

27

attention. For men, they should always be well-groomed or shaved off. Personal hygiene is highly important too.

Thus, if you follow some basic rules, if you observe the way your colleagues or bosses dress, if you pay attention to details and if you have good taste you will definitely make a good impression and you won’t break the business dress codes. Vocabulary Focus

outfit – a set of clothing, often with accessories

shade – the degree to which a colour is mixed with black or is decreasingly illuminated; gradation of darkness

troublesome – causing trouble or anxiety, difficult

sleeve – a part of a garment that covers all or part of an arm

dramatically – in a very impressive manner

casual – suited for everyday wear or use, informal

to neglect – to pay little or no attention to; to disregard; to fail to do or carry out

heels (high heel/heeled shoes) – shoes with high heels

the like – a similar kind, sort, kind, variety flats – a shoe with a flat heel attire – clothing of a distinctive style or for a particular occasion

revealing – showing or designed to show more of the body than is usual conventional

wrinkled – (of linen or clothes) not ironed, rough, unsmooth

ostentatious – characterized by pretentious, exaggerated

frayed – to become worn away or tattered along the edges; worn; affected by wear; damaged by long use

well-groomed – having a tidy pleasing appearance; attentive to details of dress

seam – a line of junction formed by sewing together two pieces of material along their margins

collar – the part of a garment that encircles the neck

Vocabulary Practice

1. Answer the following questions about the text: a. Why is it difficult sometimes to choose an appropriate outfit? b. What does a business dress code refer to? Do people dress differently for different

occasions? c. What does an appropriate business attire generally requires? Which are the best

colours to use? d. How should women dress to fit the business dress code? What should they avoid? e. How should men dress to fit the business dress code? What should they avoid? f. Can you give examples of different dress codes according to different societies or

cultures (for example religious countries, Muslim people, Asian culture, etc.)?

28

g. Which is your favourite dress style? How do you dress when you go to an interview/a business meeting/a graduation ceremony/a date? Give advice on how people should dress on such occasions.

2. Decide if the following statements are true or false: a. For women the business dress code requires short skirts, bright colours and strong

long lasting perfume. b. For men the appropriate business attire refers to a business suit or a blazer, dress

pants and a tie. c. In business, regardless the season, women must wear long-sleeved jackets or

shirts, turtleneck sweaters and opaque tights. d. Revealing clothing (showing skin, cleavage, legs, etc.) is highly appropriate in the

business world. e. Paying attention to details in business is very important: never wear wrinkled, dirty

or frayed clothes and make sure all seams are finished. f. The best colours to wear in business are black and white, dark grey and earth

tones.

3. Find the antonym in each of the following series of synonyms: a. troublesome, upsetting, worrying, easy, difficult, hard. b. dramatically, radically, modestly, noticeably, considerably, severely. c. attire, clothing, dress, outfit, garments, undress, wear. d. offensive, nice, unpleasant, nasty, distasteful, hateful. e. casual, informal, relaxed, formal, sporty, comfortable. f. ostentatious, pretentious, affected, modest, showy, exaggerated. g. well-groomed, neat, chic, elegant, messy, smart.

4. Form the appropriate word from the word in CAPITALS and use it in the sentence:

a. In business you can simplify your dressing choices ………….. if you know the rules.

DRAMATIC

b. Casual …………….. is also accepted in certain types of business.

CLOTH

c. If you wear clothes with pictures or words at work it may be considered …………………. by clients or employees.

OFFENCE

d. In the summer …………….. shirts or jackets are appropriate for women.

SLEEVE

e. In the business world …………………. clothes are to be avoided if you want to make a good impression.

REVEAL

f. Men must be ……………… all the time according to the standard business code.

GROOM

29

GRAMMAR FOCUS

Personal Pronouns

Number/person

Subject pronoun

Object pronoun

Example

Sg./1st I Me I dress up for special occasions. Mary helps me all the time.

Sg./2nd You You Do you like this suit?/Kevin loves you very much.

Sg./3rd He She It

Him Her It

He studies law in England./Did you hurt him? She loves music./ Do you know her? It doesn’t work anymore./Can you fix it?

Pl./1st We Us We are going to a party./Did he tell you anything about us?

Pl./2nd You You Do you need any help with the shirt?/I saw you yesterday.

Pl./3rd They Them They are very well-groomed./I told them about the meeting.

Demonstrative Pronouns

Number Near Far Example

Sg. This That I don’t like this dress here. How about that one over there?

Pl. These Those These shirts are bigger than those.

Possessive Adjectives and Possessive Pronouns

Number /person

Possessive adjective

Possessive pronoun

Example

Sg./1st My Mine This is my painting./Mine is the best.

Sg./2nd Your Yours Where is your sweater?/This is mine, but where is yours?

Sg./3rd His Her Its

His Hers Its

His car is not here. / This isn’t his. I like her skirts a lot. / Hers are more colourful than mine. This isn’t its (the dog’s) bone. / Do you know where is its?

Pl./1st Our Ours This is not our car. / Ours is parked over there.

Pl./2nd Your Yours These are your magazines and these are mine. / Yours are red.

Pl./3rd Their Theirs These aren’t their children./Theirs have

30

Number /person

Possessive adjective

Possessive pronoun

Example

blond hair.

Interrogative Pronouns

Subject Object Example

Person Who Whom Who told you this?/ Whom did you tell the secret?

Thing What What happened here?/What do you want to drink?

Person/ thing

Which Which came first at the party? Which will the doctor see next?

Person Whose There is one missing car. Whose hasn’t arrived yet? I found some photos. Whose did you find?

Relative Pronouns

Defining Example

Subject The person who/that called me is my friend. The car which/that hit him was not found yet.

Object The person whom/who/that I talked to is my teacher. The book which/that I bought is very good.

Possessive The students whose parents are here are very bright. I am looking for car whose owner parked it here. / I am looking for the car of which the owner parked here.

Non-defining

Subject Mrs Jones, who is American, is my teacher. The book, which is old, is very expensive.

Object Mrs Jones, whom/who I like very much, is my teacher. The book, which I bought yesterday, is very expensive.

Possessive My sister, whose car I borrowed, is on vacation. The car, whose driver left a minute age, is searched for by the police. The car, the driver of which left a minute ago, is searched for by the police.

Reflexive Pronouns

Number / person

Reflexive pronoun / Intensive pronoun

Example

Sg./1st Myself Now I can see myself in the mirror. I made the cake (by) myself.

Sg./2nd Yourself You don’t have to blame yourself for this. Have you yourself talked to him?

Sg./3rd Himself Herself

Mark sent himself the letter. The manager himself came to the party.

31

Itself Lucy sent herself a copy. / She visited me herself. My dog hurt itself. The exam itself wasn’t very difficult.

Pl./1st Ourselves We blame ourselves for this mistake. We will solve this ourselves.

Pl./2nd Yourselves Help yourselves to some more cake! You yourselves told us the news.

Pl./3rd Themselves They have to look after themselves. They themselves have never tried this product they advertise.

Reciprocal Pronouns

Each other The two friends are talking o each other. (only two people; A and B) One another The ten friends are helping one another in need. (more than to people)

Indefinite Pronouns

Pronoun Meaning Example

anybody anyone anything

no mater what person/thing Anybody can come here. There isn’t anyone absent. Is there anything wrong with this computer?

nobody no one nothing

no person/no single thing I called you house but nobody answered. Nothing happened while I was gone.

somebody someone something

an unspecified or unknown person/thing

Somebody stole my wallet, I’m sure of it! There must be something in the fridge to eat.

everyone everybody everything

all people/things We can start working because everybody is here. Don’t worry; everything is all right.

each every one of two or more people or things, seen separately

Each has to bring a new toy for the homeless children.

either one or the other of two people or things

Would you like some mineral water or still water? It doesn’t really matter; either is good for me. You either stay or leave.

neither not one and not the other of two people or things

I told both Jim and Dave the truth but neither believes me. He neither studies nor works.

little (sg.) a small amount Little is known about him.

much (sg.) a large amount Much has happened since our last meeting.

both (pl.) two people/things seen together

Dave and Tom are both here. I think both apples and bananas are good.

few (pl.) a small number of people Few have tried to climb this mountain.

32

Pronoun Meaning Example

or things

many (pl.) a large number of people or things

Many have already arrived at the party.

several (pl.) more than two but not many

They all participated and several got diplomas.

all the whole quantity of something or of some things or people

All is forgotten now. All have arrived.

most the majority Most have accepted the terms of the contract.

none not any/no person(s) He invited all his friends but none has/have come.

GRAMMAR PRACTICE

5. Choose the appropriate pronouns in each of the following sentences: a. I/me want to design suits for men. b. Mary and I/me are going to a party tonight. c. He/him told us the truth about his/him friend. d. This jacket is for she/her. e. Our/us manager is in China to sign a contract. f. The girl looked at her/herself in the mirror before she left the house. g. This book is their/theirs. h. Peter and Polly helped each other/one another with the project. i. Two of us/we are part of an international business team. j. I remember that they/them gave we/us suggestions about how to dress.

6. Complete the following sentences with the appropriate pronoun according to each sentence: a. ……………… skirt here does not match at all …………….. shirt over there. b. I told …………… sister that ………… deserves to be paid more. c. Doris and Jim smile at ………………… every time ………… meet. d. The five members of the team must respect ……………….. . e. “She is not your friend, she is …………….. !” I said. f. He talks to ………… wife every day when he is away. g. My friends love jazz; this CD is for ……………. . h. “Where is ………….. boss right now?” “…………. is on a business trip to Florida.” i. ……………… relatives are visiting them this weekend and ……….. have to wait for

…………… at the train station. j. This modern sports car is ……………; we paid 250,000€ for it.

7. Complete the following sentences with the appropriate form of relative pronouns or indefinite pronouns: a. The girl, ……… sister is your work colleague, is my best friend.

33

b. ……………….. can I go out with tonight? c. Is she the one for ……………. the letter is sent? d. The dress ……………. you intend to buy is too expensive. e. Thank you very much for the data …………… you emailed me yesterday. f. A guide is a person ………….. shows tourists the most interesting things to visit in

a city. g. ……………….. can solve this problem in five minutes. h. Is there ……………. at the door? I’ve just heard the door bell. i. You can …………… drink coffee ……… green tea, they ………. contain caffeine. j. ……………… could answer the teacher’s question, it was too difficult. k. We expect …………… at the party tonight; no one should miss it. l. You must tell us ……………. interesting about the project in order to approve it.

8. Translate the following sentences into English: a. Aceşti experŃi ne împărtăşesc experienŃa lor în domeniul modei. b. Acest băiat, ai cărui părinŃi lucrează într-o bancă, este foarte cunoscut în şcoală. c. Tamisa este un fluviu care trece prin Londra. d. A sunat şeful meu? Am înŃeles că mi-a lăsat un mesaj referitor la proiectul nostru. e. Garderoba lor nu include încă haine potrivite pentru o Ńinută formală. f. Cred că notiŃele mele s-au amestecat cu ale tale sau cu ale ei. g. Oricine poate spune ceva fie despre cum nu trebuie să te îmbraci, fie ce să nu porŃi în lumea afacerilor. h. Noi avem mari emoŃii şi trebuie să învăŃăm să ne controlăm. i. Cei doi prieteni se susŃin reciproc înaintea interviurilor dificile. j. Nouă ne plac dulciurile, aşa că această ciocolată este pentru noi.

WRITING FOCUS

9. You want to become a journalist/editor at a fashion magazine. You have seen the following advertisement posted by a prestigious fashion magazine for potential employees: Write a 30-40 line article on rules and pieces of advice on how young people should dress when working in a business company (choose one season only, either summer or winter). The article will be sent to our chief editor and the author of the best article will become a member of our team.

SPEAKING FOCUS

10. Debate on the following topics, giving arguments in favour or against your opinions: a. How important is the way people dress? b. Is it fair to have our judgments influenced by the way people dress? c. Is it true that “a book shouldn’t be judged by its covers”? d. Do we really need business dress codes? If yes, why?

Agreeing Disagreeing

I strongly/partly/totally/really agree with you. I agree with you 100 percent.

I don’t entirely agree that … I disagree …

34

I couldn’t agree with you more. I believe that is true. I support the idea that … I’m in favour of … That's so true. That's for sure. You're absolutely right. Absolutely. That's exactly how I feel. Exactly. I'm afraid I agree with ... I have to side with … on this one. No doubt about it. I suppose so./I guess so. You have a point there. I was just going to say that.

Yes, but I also consider that … We also have to take into consideration … I respect your opinion/belief, but … I’d like to add that … I have a different point of view on this. I don't think so. I'm afraid I disagree. I totally disagree. I beg to differ. I'd say the exact opposite. Not necessarily. That's not always true. That's not always the case. No, I'm not so sure about that.

35

Unit 5 Unit 5 Unit 5 Unit 5

HHOOBBBBIIEESS AANNDD IINNTTEERREESSTTSS

When we talk about hobbies we think about various free time activities that

give us pleasure and make us forget the tensions of everyday life. Hobbies are considered to be a nice escape from the routines of our life. Hobbies add color and substance to a monotonous lifestyle.

People practice hobbies for interest and enjoyment, not for financial reward. At the same time, a hobby can make you get certain skills, knowledge and experience, as well as obtain personal fulfillment and satisfaction.

Business people generally pursue expensive hobbies. They enjoy travelling, hunting, collecting art, golfing and they are almost always experts on cars. But businesspeople are no different than others: their hobbies and interests also include a large variety of activities from ping pong to skydiving. However, those proficient in business tend to gravitate toward certain activities that assist them in the workplace.

People say that to practice a hobby you need to be passionate about that activity. Nevertheless, many hobbies do have one major downfall. They can get really expensive. For instance, hobbies such as recreational flying, horseback riding, collecting model trains or luxury watches are considered highly expensive. And these hobbies speak to two things: (1) the people who practice them have been successful in business for some time; (2) they are motivated to focus on success in order to continue with those hobbies. Even usual hobbies such as bicycling or photography can cost you a lot. Bicycling involves buying a lot of tools to keep you safe and comfortable while riding. Photography means buying modern cameras as well as upgrading your accessories all the time.

The danger with hobbies is that the more you enjoy them, the more money you spend on them. Whether it’s worth buying your own horse, buying more golf courses, or getting the best fishing equipment, there’s a direct correlation between how much a hobby costs and how much you’re into it. That explains why some people own a different pair of shoes or various sports equipment for every sport they play. It’s easy to get carried away when you are having fun.

Here’s a list with the most common recreational activities that people fill their free time with.

1. Listening to Music Listening to music is probably one of the most common hobbies and interests.

There are few people in the world that wouldn’t be fond of music. People like

36

different types of music and whether you are a fan of jazz or classical music, heavy metal or dance, music is often part of your life.

2. Reading Books Some people enjoy spending their time reading books, magazines or

newspapers. The best way to acquire wisdom is by cultivating the habit of reading books. A good book can be satisfying and can teach us about plenty of subjects. The best way to cultivate this habit is to understand that reading is a pleasure. Always keep a good book around you and set some time for reading every day.

3. Stamp Collection and Coin Collection Some interesting hobbies and interests are stamp collection and coin

collection. Thousands of people across the world have the habit of collecting stamps and coins, which requires passion and attention. Some people collect antiques and artwork, but these hobbies are more rare, because antiques and artwork are usually expensive.

4. Playing Musical Instruments Many studies show that people who play music have generally higher IQ scores

than those who aren’t musical. People who play music acquire patience and discipline and are able to communicate their emotions. The best thing would be to develop this habit as early as possible. However, it is never too late to cultivate good habits.

5. Dancing Dancing is another hobby that many people in the world have. Dancing is

greatly beneficial in keeping people young. It’s about balance, social satisfaction, and self-confidence.

6. Gardening Aside from improving our environment and having your own source of flowers,

fruit and vegetables, gardening is permanently encouraged as it offers stress reduction, physical benefits, patience and health. Remember that many specialists consider that spending time in a garden has physical and emotional healing effects.

Vocabulary Focus

escape – the act or an instance of getting free from danger or confinement

self-confidence – great faith in oneself or one's abilities

monotonous – causing lack of interest downfall – a change to a lower state or level

enjoyment – the feeling experienced when one's wishes are met

proficient – having exceptional knowledge, experience, or skill in a certain field

fulfillment – the state of being actual or complete

habit – a usual manner of behaving or doing

to pursue - to go after, to go in search of to acquire – to receive as return for effort

37

Vocabulary Practice

1. Answer the questions: a. What interests do you have outside your job and school? b. Do you believe that activities such as going shopping, playing computer games,

watching TV or online chatting could be considered hobbies? c. What nonprofessional activity do you find most inspirational and why? d. Enumerate some hobbies that you like and talk about their benefits. e. Which hobbies are the most expensive and which are the cheapest? f. Are there any dangerous hobbies? g. What hobbies would you like to try but have no courage in trying them out yet? h. Comment on the following quotation: “A hobby a day keeps the doldrums away.”

2. Choose the right definition for each activity:

1. painting a. to gather pens for enjoyment 2. writing poems b. visiting different places in the world for various

purposes like business, leisure, education or recreation 3. collecting pens c. a form of diving with the help of a scuba set to

breathe underwater 4. playing chess d. the most popular form of auto racing 5. scuba diving e. a method by which thread is turned into cloth or other

fine crafts (by hand or machine) 6. fishing f. the art of creating pictures by recording them on a

photographic film 7. car racing g. the process of covering surfaces with paint for artistic

effects 8. traveling h. playing a game with 16 pieces, played by two players

on a white and black board with 64 squares 9. photography i. writing compositions in verse in order to transmit ideas

or emotions in an imaginative way 10. knitting j. the activity of trying to catch fish

3. Fill in with the following words: has, before, usually, rides, Wednesday, a lot of, concerts, rarely.

Mary Wilson has …………. hobbies and interests. She usually gets up early so she can run ……..…. going to work. She doesn't often have time to ski, but she occasionally goes skiing during the winter. Mary often ………….. a horse somewhere near her home. She also loves music. She always goes to choir practice on ……………. evenings and sings in church on Sundays. She doesn't have much extra money, so she rarely goes to …………. in the city. She ………….. watches TV because she likes spending her time in the open. She usually goes to the gym if it's raining outside. She doesn’t stay alone because she …………. a lot of friends. She occasionally does something alone, but she …………. does her activities with one of her friends. She's a happy woman!

38

Now read attentively the text above and choose the correct answer to the next questions based on Mary Wilson’s hobbies and interests. Each question has only one correct answer. 1. Why does Mary Wilson usually get up early?

A) She gets up early to run before work.B) She gets up early to go to work. C) She gets up early to have breakfast.

2. How often does Mary Wilson go skiing? A) She often skis. B) She occasionally skis in winter. C) She rarely skis in winter.

3. How often does Mary Wilson ride a horse? A) She rides a horse every day. B) She often rides a horse. C) She never rides a horse.

4. What kind of music does Mary Wilson like doing? A) Playing the violin B) Singing C) Playing the piano

5. How often does Mary Wilson go to concerts in the city? A) Every Sunday B) Rarely C) Never

6. How often does Mary Wilson watch TV? A) She usually watches TV every night. B) She rarely watches TV. C) She never watches TV.

7. What does Mary Wilson usually do if it's raining? A) She goes outside. B) She goes to the gym. C) She calls friends.

8. How often is Mary Wilson alone? A) She is often alone. B) She isn't often alone. C) She is usually alone.

4. a. Use the words interest, interesting, interested in different contexts.

b. Write nouns derived from the following verbs:

Verb Noun Verb Noun

to practice to fulfil

to know to read

to experience to collect

c. Find the opposites:

Word Opposite

1. to enjoy

2. monotonous

3. different

4. expensive

5. the best

6. usually

39

GRAMMAR FOCUS

THE NUMERAL

Cardinal numerals Ordinal numerals

1 – one 2 – two 3 – three 4 – four 5 – five 6 – six 7 – seven 8 – eight 9 – nine 10 – ten 11 – eleven 12 – twelve 13 – thirteen 14 – fourteen 15 – fifteen 16 – sixteen 17 – seventeen 18 – eighteen 19 – nineteen

20 – twenty 21 – twenty – one 22 – twenty – two 30 – thirty 40 – forty 50 – fifty 60 – sixty 70 – seventy 80 – eighty 90 – ninety 100 – one hundred 101 – one hundred and one 154 – one hundred and fifty-four 500 – five hundred 1,000 – one thousand 1,000,000 – one million

1st – the first 2nd – the second 3rd – the third 4th – the fourth 5th – the fifth 6th – the sixth 7th – the seventh 8th – the eighth 9th – the ninth 10th – the tenth 11th – the eleventh 12th – the twelfth 13th – the thirteenth 14th – the fourteenth 15th – the fifteenth 16th – the sixteenth 17th – the seventeenth 18th – the eighteenth 19th – the nineteenth

20th – the twentieth 21st – the twenty-first 22nd – the twenty-second 30th – the thirtieth 40th – the fortieth 50th – the fiftieth 60th – the sixtieth 70th – the seventieth 80th – the eightieth 90th – the ninetieth 100th – the hundredth 101st – the hundred and first 154th – the hundred and fifty-fourth 500th – the five hundredth 1,000th – the thousandth 1,000,000th – the millionth

PRESENT TENSE SIMPLE

Affirmative Negative Interrogative

S + present simple (V1) S + do / does not + verb Do / Does + S + verb?

I/you/we/they work He/she/it works

I/you/we/they do not (don’t) work He/she/it does not (doesn’t) work

Do I/you/we/they work? Does he/she/it work?

Uses: Examples:

1. to express regular routines and habits

Alison often watches TV after dinner. Jack doesn't spend too much time on reading.

2. to express general truths The Earth moves around the sun. A tailor makes clothes. Water boils at 100 degrees C.

3. to denote an event which is planned for the future

The exams begin at 10 o’clock tomorrow. Our winter holiday starts on December 22nd.

4. to express instructions, sport commentaries, exclamations, stage directions, etc.

People read safety directions before opening the bottle. The player hits the ball and scores. Here comes our bus!

Time expressions: always, usually, often, sometimes, occasionally, seldom, rarely, in the morning, on Mondays, every day/week/month/year, etc.

Note: the verb ”to be” does not take the auxiliary verb “do” in the negative or the interrogative form. Examples: I am not from Seattle. Are you married?

40

GRAMMAR PRACTICE

5. Fill in the blanks with the suitable numerals: twenty-nine, eleven, three, twenty thousand, the first, seven, twenty-eight, second, two, first

1. I have .... computers at home: one is mine and one is for my sister. 2. My .... impression is that he is very good at English. 3. They invite me to .... interview next week. 4. I need .... euros to buy a car for my wife. 5. Each football team consists of .... players. 6. This is your .... chance; this time you must keep your promise. 7. We want to buy .... kilos of apples. 8. February has ..... days in a leap year. 9. Four times seven are .... . 10. .... is my lucky number.

6. Read the following numerals and dates: 1. 22nd October 1982 2. 12th April 1961 3. 6th March 1876 4. 8,454 km 5. 1,206 kg 6. 822 kg 7. 3,370 km 8. 5,895 m 9. 19,888,000 lei 10. 25th July 1939

7. Put the verbs in brackets in the present simple: Hi everybody! I'm Sue. I like habits and routines. I always (to do) .... the same things

at the same time. For example, I (to drink) .... two glasses of milk in the morning and I usually (to arrive) .... at school at twenty five past eight. I often (to wear) .... jeans and T-shirts. I (to love) .... pop music. I also (to love) .... planting flowers in the garden. I (to have) .... a beautiful garden.

I (to live) .... with my parents and my brother, Tom. He is very different from me. He never (to arrive) .... on time for lunch. He (to like) .... new clothes and fashion, and he (not to listen) .... to pop music. He (to play) .... hard rock in a group called "Metal Bananas". We (to be) .... in an English club called “The Happy Gang”. We (to go) .... to the club on Saturdays.

8. Correct the verb-related mistakes in the following sentences: 1. Our Management exam begin at 9.30 tomorrow morning. 2. Tom watchs TV every evening before going to sleep. 3. Vegetarians does not eat meat. 4. Do she like reading books? 5. A liar is someone who doesn’t tells the truth. 6. Do they goes to the theatre on Saturdays? 7. The boys in my group usually apologizes for their rude behaviour.

41

8. Students has hobbies such as reading, dancing or listening to music. 9. Adam play the guitar when he return from school. 10. Do Johnny and Danny goes swimming every day?

9. Choose the right variant: 1. Tom .... like chocolate icecream. don’t doesn’t 2. I .... understand my friends sometimes. don’t doesn't 3. Dr Watson .... drink alcohol. don’t doesn't 4. We .... like rock music very much. doesn’t don't 5. Your friend .... eat sweets. doesn’t don't 6. .... Mr Smith live in New York? do does 7. Sunflowers .... grow in cold climates. don’t doesn't 8. Children usually .... like vegetables. doesn’t don't 9. .... it often rain in your country? does do 10. She .... remember anything of the accident. don’t doesn't

10. Translate the following sentences into English: a. Dacă îl întâlnesc astăzi, îi povestesc despre planurile noastre de vacanŃă. b. El trece pe la biroul meu în fiecare marŃi dimineaŃa. c. Prietena mea nu are timp liber, deci nu are nici hobby-uri. d. Lumina călătoreşte mai rapid decât sunetul. e. El speră să se mute la o nouă companie din New York anul viitor. f. Fotbalistul loveşte mingea şi înscrie. g. Plecăm de la Londra miercuri la ora 10 şi sosim la Paris la ora 14. h. Lui Ben nu îi place să citească în timpul liber, însă ascultă muzică în fiecare zi. i. De obicei ne luăm vacanŃă iarna pentru că ne place să schiem. j. Oamenii de afaceri practică hobby-uri costisitoare precum golful, călăria sau vânătoarea. k. Noi plătim 255.000 de euro pentru această casă. l. Eu am 28 de ani, iar vărul meu are 33 de ani. m. Al doilea student de acolo este prietenul meu. n. Este a patra oară anul acesta când mergem în Anglia. WRITING FOCUS

11. What are the strangest hobbies you have heard of? Find information on these hobbies and present them in writing. Write a 200-word essay.

SPEAKING FOCUS

12. Debate on the following topics, giving arguments in favour or against your opinions: a. How important is to have a hobby? b. Do people need hobbies? If yes, why? c. Do you think that a person’s character and standard of living have any kind of

influence on the hobbies that the respective person chooses to have? d. Make a dialogue with your colleague in which you talk about your hobbies. Mention

the days and the times when you practice these activities. e. Do you consider that there are certain popular hobbies in your country? Discuss

this topic with your colleagues.

42

Unit 6 Unit 6 Unit 6 Unit 6

PPEEOOPPLLEE AANNDD WWOORRKKPPLLAACCEESS

Choosing your job is one of the most important and difficult decisions people face in life. All of us want to enjoy what we do for a living. But for a job to provide satisfaction, it must give the reward a person expects. Earning the highest possible salary is the top priority for most people. Others get their greatest satisfaction from helping other people, working for charity organizations, managing a risky business or solving difficult issues. Starting with the 1990s, a lot of surveys show that people want more from work than money. While managers consider that the most important aspect of work is money, workers say that personal time and attention from their supervisor is another motivational factor at work.

According to their level of education and specialization, people can choose between professions and trades. A profession is a vocation based on specialized educational training whose purpose is to supply counsel or services to others. Examples of professions are: lawyers, doctors, accountants, economists, professors. Doing manual work in a particular field of activity such as constructions, electricity or social services is considered a trade.

On the other side, when looking for a job, you need to observe the various fields of activity in which you can choose your occupation: healthcare and education, engineering and construction, financial management and accountancy, law and administration, journalism and public relations, sport and tourism and the list could go on.

Finding the right job for you isn’t a matter of luck. It is your responsibility to plan for the future and take the necessary steps to reach your goals. You must plan wisely. This means using every tool available to help you recognize your occupational potential. In many ways, job happiness depends on being yourself. That’s why it is important to make a detailed inventory of your interests, skills, natural abilities and personality traits. You must also take a look at your achievements in school, your leisure-time activities and the part-time jobs you have had.

There are some job presentations made by two college students who live in different countries and who have recently been employed for the summer break.

“Hi. I’m Charlotte Stone and I work as a sales-assistant at Macy’s in London. Getting this job was quite easy. All I had to do was to complete the online application and forward it to the Human Resources Department. I have a part-time job, which means that I work 20 hours a week. Most employees in the store have a full-time job that includes 40 hours a week, and they can also do overtime work, which involves working longer and earning more money. Every employee has a contract, an agreement that clearly stipulates the period of employment and the salary. Hourly pay starts around £8.00. My boss is very nice to us as long as we respect the company’s policy: ‘Wear comfortable shoes, have a good attitude, smile at your customers, and remember the ones who come back!’. I can say that I am satisfied with my new job.”

“Hello. My name is Morgan Mason. I work as a junior accountant in Vancouver, Canada. Every day I commute by train from White Rock to the company’s head office

43

located in Vancouver. I leave home at 7:45, I get to work at about 9:00 and I finish at 5 p.m. I love my work because it helps me enrich my experience and improve my skills in accounting, computers and other areas. Sometimes I have to talk to the new customers, and that helps me develop my communication abilities. I never do shift work. I get my remuneration once a month, on the 20th and I am well-paid. I am really happy with my new job!” Vocabulary Focus

reward – something offered or given in return for a service performed

earning – an increase usually measured in money that comes from labor, business, or property

to supply – to offer what is needed for a task or activity

survey – a close look at or over someone or something in order to judge condition

counsel – an opinion suggesting a wise or proper course of action

wisely – having or showing deep understanding and intelligent application of knowledge

achievement – a successful result brought about by hard work

to employ – to provide with a paying job

to improve - to make better, to correct

to enrich – to make better, to upgrade

customer – a person who buys a product or uses a service from a business, client

shift work – an employment practice designed to make use of the 24 hours of the clock; it refers to work schedules divided in night shifts and day shifts

Vocabulary Practice

1. Answer the questions: a. What are the main motivations for working, in your opinion? Which of them is the

most relevant to you? b. What jobs have you had in your life and what did you like and dislike about them? c. Enumerate some strategies that you would implement at your job in order to improve

the quality of work. d. What is a profession? Give examples of professions and talk about their advantages

and disadvantages. e. What is a trade? Give examples of trades and talk about their advantages and

disadvantages. f. Write the word family of the verb to work. Make sentences with each word you find. g. What are your career goals for the future?

2. Find the suitable job title: •••• I like computers and I know how they work. •••• I plan, design and oversee the construction of different buildings. •••• I practice law and I provide legal services to people or businesses.

44

•••• I cure people who are ill. •••• I work in a multinational company where I control the financial situations. •••• I teach in an academic environment. •••• I buy and sell stocks on the stock market. •••• I build cars, roads, bridges, machines, etc. •••• I work for the accounting department. •••• I repair all types of cars.

3. Say if people normally feel happy or unhappy in the following situations: a) You are out of job. b) You find work very rewarding. c) You haven't been given a pay rise for years. d) You have been recently promoted on a higher position. e) Your work consists of long night shifts. f) You have a steady income. g) You are not paid for working overtime. h) Your perks have been eliminated. i) You have been put in charge of the marketing department. j) Your job is very demanding.

4. Match the terms with the right definitions. Then use the terms from 1-10 to complete the sentences below:

1. benefits a. person who sets up and runs his or her own business

2. competition b. an evaluation of an employee’s work by an employer

3. contract c. the lowest pay rate that a business can legally pay its workers

4. entrepreneur d. unfair treatment because of race, sex, colour, religion, age, etc.

5. to take early retirement

e. various compensations provided by an employer to employees, in addition to their normal salaries, such as health insurance, sick leave, etc.

6. minimum wage f. a regular payment to a retired person by a former employer

7. job review g. to retire before the company's official retirement age and receive fewer benefits

8. discrimination h. to dismiss from a job

9. pension i. rivalry among those who are attempting to achieve the same goal

10. to fire j. verbal or written agreement between two or more persons with mutual obligations

a. The ….…. for that good job was fierce; more than 200 people applied! b. Fast food restaurants usually pay beginning workers no more than the ........ ........ . c. Companies that refuse to hire workers over 40 years old are guilty of age …..…. . d. With each new job promotion, Harley also got new …….. . e. After many years of hard work, grandpa will retire and receive a …….. from the

company where he was employed.

45

f. Thomas has always wanted to be his own boss; he plans to become an …….. . g. The new manager decided to …….. David Smithfield because he violated the

company’s policy. h. At Andy’s six-month …….. …….., the supervisor made several suggestions for

improvement. i. Our written …….. clearly stipulates who suffers the losses in case of bankruptcy. j. In case some aged or sick employees decide to ……… ………. …….. we can offer

good pension benefits for them.

1. Complete the gaps with the appropriate missing words and then translate the text and the sentences into Romanian.

famous, work, start up, the first, are, businesses, determined, bright, money, sold, able to, until

Entrepreneurs are people who ….. and run their own businesses. The U.S. economy was built on the ….. ideas and hard work of its entrepreneurs. Some of America’s first entrepreneurs were trappers who ….. wild animal furs. Henry Ford was a ….. American entrepreneur. In 1913, he developed ….. assembly line to produce cars.

What does it take to be a successful entrepreneur? Small business owners ….. independent, confident people. They are risk takers who like challenge and are ….. make decisions on their own.

Many entrepreneurs work 12 hours a day. To save ….., a small business owner often does the …… of many people: owner, office manager, bookkeeper, and salesperson. Sometimes, entrepreneurs become wealthy. But the reality is that about one-fourth of all new ….. fail within the first three years. Often, the business was launched without enough capital - the money needed to set up and run the business ….. it makes a profit. Most entrepreneurs don’t make a great deal of money. But people who are ….. to work for themselves often value independence more than a high income.

profession, skilled worker, unemployed, pay slip, apprentice, commuter

- A ….. is a person who drives to work every day from a big distance. - A ..… is any worker who has some special skill, knowledge, or usually acquired

some abilities in his work. - An ..… is someone who learns a skilled trade on the job, under the direction of more

experienced workers. - A person who does not have a job, is available for work, and is actively looking for

work is named ….. - A ..… is a large set of skills that people acquire by specialized educational training,

the purpose of which is to supply service to others and earn money. - A ..… is a piece of paper included with a person's salary payment, that records how

much money the person has earned and how much tax or insurance etc. has been taken out.

46

GRAMMAR FOCUS PRESENT TENSE CONTINUOUS

Affirmative Negative Interrogative

S + am/is/are + Verb-ing S + am/is/are + not + Verb-ing Am/is/are + S + Verb-ing?

I am working We/You/They are working He/She/It is working

I am not working We/You/They are not working He/She/It is not working

Am I working? Are we/you/they working? Is he/she/it working?

Uses: Examples:

1. to express an action that is happening at the moment of speaking

Alison is watching TV now. I’m wearing a coat as it is very cold. The wind is blowing outside.

2. to express an action that extends over a longer period of time including the moment of speaking

I am reading a play by Shakespeare. My mom is planting some flowers in the garden. Listen! He is playing the piano.

3. to express one’s immediate plans for the near future

I am going to ConstanŃa tomorrow. We are having dinner in town tonight.

Time expressions: now, right now, just now, at the (present) moment, today, tomorrow, tonight, this moment/week/month/year etc.

Notes: 1. The verb ”to be” does not normally appear in the continuous aspect but sometimes it is used to express a temporary action and changes its meaning. Examples: I’m in the classroom now. I am being rude today. 2. Verbs of perception such as hear, see, smell, look, taste, feel, sound, appear as well as cognitive verbs such as believe, know, think, understand, forget, suppose change their meaning when they are used in the present continuous form. Examples: The food tastes delicious. My mother is tasting it. I see a butterfly. I’m seeing the manager tomorrow. I think he is a good person. I’m thinking of my mother.

GRAMMAR PRACTICE

6. Fill in the gaps with the present continuous form of the verbs in brackets: 1. The two businessmen ……….. (not attend) the meeting today. 2. The company manager ………… (delegate) new tasks to the employees. 3. Customers ………….(complain) about the bad services. 4. Wait! We ………. (work) on a new project at the moment. 5. John …………. (travel) to Tokyo tomorrow for a business meeting. 6. Today we ………… (invite) our business partners to have lunch together. 7. …… Ann ……. (present) the new marketing strategies? 8. The annual income …… dramatically ……(decrease) due to the economic crisis. 9. The sales department ……… (implement) the new management policies.

10. I ……….. (apply) for a financial expert position now.

47

7. Underline the right verbal form:

1. We pay / are paying local taxes every year. 2. Listen! They talk / are talking about your promotion. 3. Tom is / is being an appreciated employee. 4. The two colleagues share / are sharing the same office. 5. The new employees do / are doing overtime work this week. 6. We look / are looking for a new job. 7. People who work / are working hard usually earn / are earning more money. 8. My full-time job includes / is including working 40 hours a week. 9. Most businesses employ / are employing less people this year. 10. Bankers criticize / are criticizing the global economic situation.

8. Put the following verbs into the present tense simple or present tense continuous:

1. …. you… (know) that man over there? Actually, I do. He is Helen’s husband. 2. Are you doing anything tomorrow evening? Yes. I ..… (see) Jack at nine o’clock. 3. I ….. (see) you have bought a new car. Yes, I have and I like it very much. 4. What’s that noise? Our neighbors ….. (have) a party. 5. Graham … (have) a new computer. I know. I’ve already seen it. 6. Your perfume ….. (smell) nice. What is it? 7. What …. you… (look) at? Some photos I took during my holiday. 8. You ….. (look) very pretty today. Thank you. I’ve just had my hair cut. 9. I ..… (think) we are being followed. 10. What …. he ..… (think) about? I guess he ..… (think) about the party tonight. 11. She ….. (be) usually generous, but today she … (be) a little selfish. 12. I’m sorry, but I ..… (not understand) what you mean.

9. Translate the following sentences into English: a. Directorul băncii îşi pregăteşte dosarul de pensionare. b. Compania face profituri mari anul acesta. c. Eu aplic pentru un job cu jumătate de normă acum. d. Aceşti muncitori nu mai lucrează în schimbul de noapte săptămâna aceasta. e. Vânzările scad acum din cauza crizei economice. f. Luna aceasta noi facem naveta la o filială a companiei. g. Vă pregătiŃi documentele pentru interviu? h. Şeful nostru este o persoană calmă, însă zilele acestea el este foarte nervos. i. Directorii companiei vorbesc despre un posibil faliment. j. Spitalele din străinătate angajează 2.000 de doctori români anul acesta.

WRITING FOCUS

10. a. Make a detailed description of your job. Make reference to the working conditions, work schedule, coworkers, management, salary and other benefits, etc.

b. You see the following job announcement in a business magazine. Write an email in which you apply for the job offered below.

48

Job Announcement Dear candidates, We are glad to inform you that we have job openings in our company. We are one of the leading Electronics and Marketing Companies in the U.S. We are now looking for dedicated and energetic professionals who have at least 2 years of experience in Marketing & Sales to occupy the various positions in the company. We offer compensations and benefits that are best in the industry as well as a professional working environment. Please forward your applications to simpson.bobby@global.com at the earliest, only if you meet our requirements. All applications are sent to our corporate office to face the interview. With regards, Simpson D. Bobby, Human Resources Manager, Global Electronics Inc.

SPEAKING FOCUS

11. Debate on these topics:

a. Job vacancies are displayed on the Internet all the time. Why is it then so difficult for some people to get a job?

b. Businesses should hire employees for their entire lives. Do you agree or disagree? Use specific reasons and examples to support your answer.

c. Some people prefer to work for a large company. Others prefer to work for a small company. Which would you prefer? Motivate your choice.

d. Make a dialogue with your colleague in which you talk about the jobs you would most and least like to have. Present the reasons of your choice.

49

Unit 7Unit 7Unit 7Unit 7

BBUUSSIINNEESSSS MMEEAALLSS && SSOOCCIIAALLIIZZIINNGG

In most parts of the world, having lunch or dinner together with your business

partners or work colleagues has become an important part of doing business. In some parts, such as North America, eating meals is a way of building a

relationship or celebrating a partnership, while in other cultures, such as China, making deals often gets done over the dinner table. In other countries, having a drink after work with colleagues is a popular way to relax. This kind of socializing helps you get to know each other and build team spirit.

To attract customers who are just getting off work, many bars and clubs have a “happy hour”. This is a promotion in the early evening, usually lasting an hour or so, when pubs and bars offer special prices on drinks, such as “buy one get one free” or “all drinks at half price”.

All these promotions invite people to socialize with colleagues during happy hour or during other informal occasions. Consequently, it is vital to have some skills that help you deal with different types of after-work social activities. Whether you have dinner or not, whether you drink alcohol or not, in many places around the world you will likely be invited to the restaurant or to a pub with colleagues or business partners. And no matter if you are doing business or just socialising with your colleagues, it is important to be able to handle the basics of dining out. This includes ordering food, recommending dishes, proposing a toast, and paying for the check, among other things. You must also know how to offer to buy drinks for others and how to make polite excuses when you’ve had enough or when it’s time to go.

In the dialogue below, we follow Mario, the representative of an Italian company, on his visit to the United States of America. As planned, he is having dinner in Las Vegas with Sarah, his American business partner. Dave, one of their new customers, has also joined them.

The group has just arrived at the restaurant. They are hungry and they want to order as soon as possible. Waiter: ”Good evening. A table for three?” Dave: ”Yes, please.” Waiter: “Smoking or non-smoking?” Sarah: “Non-smoking.” Waiter: “Right this way.” They walk to a table. Mario, Dave and Sarah sit down and the waiter gives them the menus. Waiter: “I’ll be back in a few minutes to take your order.” Waiter (five minutes later): “Are you ready to order?” Mario: “I think so, but can I ask you something? What is beef Stroganoff?” Waiter: “It’s beef cut into small pieces and served in a sour cream and white wine sauce.” Mario: “Ok, that sounds good. I’ll have that.”

50

Waiter: “Excellent. And that comes with your choice of French fries, fried mushrooms or rice.” Mario: “I’ll have rice.” Waiter: “Anything for you?” Dave: “I’ll have the onion soup. And then a Greek vegetables salad.” Waiter. “OK. What else can I get you?” Sarah: “Is the spaghetti and meatballs a very large dish?” Waiter: “Yes, it’s a big one.” Sarah: “Oh, I’m not very hungry.” Waiter: “Then can I recommend chicken with mushrooms? That comes with a white sauce, but it’s not too big.” Sarah: “Ok. I’ll take chicken and mushrooms and a salad to start.” Waiter: “Very good. And what can I get you to drink?” Mario: “A bottle of wine for me.” Dave: “A cup of coffee, please.” Sarah: “I’ll have some orange juice.” Waiter: “Oh, I’m afraid we’re out of orange juice. But we have pear, apple, grape, kiwi and banana.” Sarah: “Kiwi and banana? That sounds interesting. I’ll try that.” Waiter: “Excellent. I’ll be back with your drinks in a minute.” Vocabulary Focus

meal - the foods eaten or prepared for eating at one time; a time or occasion when food is eaten

bill - a document that says how much money you owe for something you have bought or used

to have a drink/lunch/dinner - to serve the meals of the day (morning/noon/evening)

to order - to request (food or drinks) from a restaurant

pub - a building or room especially in where alcoholic drinks and often food are served

dish - a part of a meal served at one time

to socialise (Am. socialize) - to talk to and do things with other people in a friendly way

to handle - to deal successfully with (a person, situation, etc.)

Vocabulary Practice

1. Answer the following questions: a. Do you usually prefer to eat out or to eat at home? b. How often do you go to the restaurant with your family? c. What is your favourite restaurant? d. What is your favourite food to order there? e. Have you ever had a business lunch? f. Is there any difference between a restaurant, café, bar, pub, cafeteria? g. Have you ever been to a Western restaurant (for example in the US or Europe)?

Were there any differences in customs between your country and the West? h. What is your opinion about fast-food restaurants? i. What’s the purpose of business meals? Are they the same all over the world?

51

2. Put the words below in the right order to make up sentences:

a. and Green sour sometimes usually mango is sweet. b. as are chocolate fattening foods Rich and creamy cake such. c. chips crispy are and Potato salty. d. smooth of and peanut crunchy extra kinds are butter 3 crunchy The. e. or crust thin like you Do pizza your thick? f. to raw healthy vegetables is fresh eat It. g. it can chewy meat you If long too cook be. h. to like rice add soy to vinegar sauce and I soup. i. roll you crust dough the Can for pie the? j. spicy dishes Many the to brought potluck party people.

3. Choose the right word from the box to fill in the gaps:

piece, glass, cup, bottle, bowl, can, slice, basket, bunch, carton, bar

a. I would like to have a ............ of beer. b. May I have a ........... of bananas please? c. I would like to have a ...........of noodles. d. Would you like a ............of lemon in your coke? e. May I have a ........... of cake please? f. Please pass me that ........... of milk. g. May I have a ........... of soda please? h. Can you get a me a ............ of apple juice please? i. Can you open that ........... ...of wine please? j. Lilian is feeling sick, let’s get her a ........... of fruits. k. May I have a .............of coffee please? l. I want a .................... of chocolate.

4. a. Match the nouns to the adjectives, then say which of the expressions are positive and which are negative:

Adjectives Nouns slow menu poor service

helpful atmosphere varied prices warm staff high location

Example: slow service (negative) b. What should(n’t) a good restaurant have? Use your answers to make up sentences, as in the example:

Example: A good restaurant should not have …. However, it should have ….

52

5. Put the dialogue in the correct order:

a. No problem. I’m happy to help you. Goodbye. b. Oh, really. That’s great news. Sorry to have troubled you. c. Let me see. Here it is. The items you ordered were sent out today. d. What seems to be the problem, Ms Joshed? e. Hello. This is Diana Joshed, customer no RJ234. I’m calling about my order. f. I haven’t received any goods yet and I placed my order over three weeks ago. g. Hello. BMS customer services, Maya speaking. May I help you?

1. 2. 3. 4. 5. 6. 7. e

GRAMMAR FOCUS PRESENT PERFECT SIMPLE

Affirmative Negative Interrogative

S + has/have V-ed/(V3) S + has not/hasn’t/have not/haven’t+V-ed/V3

Have / Has + S + V-ed/V3?

I/you/ /we/they have lived in England.

He/She/It has had breakfast.

I/you/he/she/we/you/they have not (haven’t) lived in England.

He/She/It has not (hasn’t) had breakfast.

Have I/you/ we/you/they finish/come?

Has he/she/it/ had breakfast?

Uses: Examples:

1. to put emphasis on the result She has written five letters.

2. to denote an action that is still going on School has not started yet.

3. to express an action that stopped recently She has cooked dinner.

4. to express a finished action that has an influence on the present

I have lost my key.

5. to denote an action that has taken place once, never or several times before the moment of speaking

I have never been to Australia.

Time expressions: already, ever, just, never, not yet, so far, till now, up to now

Notes: 1. to form regular participles, we add –ed to the infinitive form: work – worked; play – played 2. Many common verbs have an irregular past participle. See the list of irregular verbs at the end of this course book. Examples: go – gone, write – written, eat – eaten.

GRAMMAR PRACTICE

6. Put the verbs into the present perfect simple, affirmative or negative: a. I (not / work) ……………………today.

53

b. We (buy) ……………………….a pizza from fast-food. c. We (not / plan) …………………….our holiday yet. d. Where (be / you)…………………………..lately? e. He (write)………………………….five letters to his American penpals. f. She (not / see)………………………..her brother for a long time. g. (go/ you)………………………..to school this week? h. Our seminars (not / start)……………………yet. i. (speak / he) already ……………………to his boss? j. No, he (have / not)…………………….the time yet.

7. Write questions using the verbs in the present perfect simple: a. you / answer / the question b. Jenny / lock / the door c. Walter / call / us d. you / see / the picture e. your friends / get / the best prize f. it / rain / a lot g. how often / they / go / to his concert h. Maureen / already watch / the film i. how many books / Bob / read j. ever / you / be / in London

8. We use the present perfect to express what has (not) happened so far. (Note that no time in the past must be given – otherwise you have to use past tense simple.) Read the following article and put the verbs in present perfect simple:

Loch Ness is a lake between the Scottish towns of Inverness and Fort Augustus. The word loch is Scottish for lake. Loch Ness is about 37 km long and extremely deep, the deepest part is 226 m. Loch Ness is famous for its friendly monster, Nessie. Most people think that this is only a legend, but every year tourists from all over the world come to Loch Ness and hope that they will see the monster.

a. Tourists from all over the world (be) …………. …..to Loch Ness. b. Most of them (see / not) ……….. Nessie, however. c. Only very few people say that the Loch Ness Monster (appear) ……….. in front of them. d. Even scientists (come) ………… to Loch Ness to find the monster. e. And the boss of the Guinness brewery (promise) ………… to pay 500,000 pounds to

the person who catches Nessie.

9. Translate the following dialogue into English: Michelle: Cred că ospătarul ne-a uitat. Aşteptăm aici de peste o jumătate de oră şi

nimeni nu ne-a luat comanda încă. Robin: Ai dreptate. A trecut pe lângă noi de cel puŃin douăzeci de ori. Probabil crede că

am comandat deja. Michelle: Priveşte acel cuplu de acolo! Sunt aici de cinci sau zece minute şi deja

mănâncă. Robin: Trebuie să îşi dea seama că nu am comandat încă. Stăm aici de mai mult de o

jumătate de oră privindu-l cu insistenŃă.

54

Michelle: Nu ştiu nici măcar dacă ne-a observat. Aleargă de la o masă la alta să ia comenzi şi să servească mâncare.

Robin: Dar nu s-a uitat în direcŃia noastră niciodată. Să mergem la alt restaurant! WRITING FOCUS

10. a. Write a letter addressed to the manager of a restaurant in which you complain about the bad services in his restaurant (hot soup, rude waiters, dirty tablecloth, etc.). b. Write a recipe for a cookbook. Think of one of your favourite foods. SPEAKING FOCUS

11. a. What kind of problems can anyone encounter when going to a restaurant? b. Can you think of a time when a restaurant ran out of something you ordered? c. Have you ever had very bad customer service? d. Has the waiter/waitress ever mixed up your order/overcharged you/been very rude? e. Are you allergic to certain foods? f. Discuss about the types of food and drinks recommended on a diet. g. What is your opinion on genetically modified foods, are you in favour or against using

them? Give reasons to support your answer. h. Are you a vegetarian or a meat eater? What is the difference between them? Whiat

diet should people choose in order to have a balanced diet?

55

Unit 8Unit 8Unit 8Unit 8

SSTTAAYYIINNGG IINN AA HHOOTTEELL

Hotels are establishments that provide paid accommodation to the guests who rent a

furnished room by the night. This is usually a more expensive option than hostels, motels, guest houses, inns or chalets, but hotels do come in handy when you need a good sleep.

Arriving at a hotel after a long, hard day of travel, Sarah Miller needs to do one last thing before she can take a hot shower and relax in front of the TV – she has to check in. That means registering for the room by filling in a form and giving the hotel receptionist her credit card number. Checking in at hotels is an important part of travel, whether it’s for business or for pleasure. Here is the dialogue at the reception of the hotel: Receptionist: “Good afternoon, Madam. Can I help you?” Sarah: “Good afternoon. I’d like room in your hotel, please.” Receptionist: “Have you made any advance booking, Madam?” Sarah: “I’m afraid I haven’t done any room reservation. I tried to book a room online, but the hotel reservation software was not working.” Receptionist: “What kind of a room would you like? A single room or a double room?” Sarah: “A single room, please.” Receptionist: “Let me see (looking into the register). We are fully booked up at this time of the year. No, we haven’t any available single rooms, Madam.” Sarah: “But, please, try to help me out. I don’t know where else to stay in this area.” Receptionist: “How long do you want to stay?” Sarah: “Just for one night. I’m catching the afternoon train tomorrow.” Receptionist: “All right then. I think we can accommodate you in one of the rooms booked by a German group. Their plane has been delayed and they will arrive tomorrow at lunch time. Will that be all right, Madam?” Sarah: “That’s great! Thank you very much.” Receptionist: “You are welcome. The room is on the second floor. Will you please fill in your name and address in the registration book, please. I also need your passport and your credit card number. The price is £65 per night.” Sarah: “Does the room tariff include any meals?” Receptionist: “Only breakfast. The other meals are charged separately. Here is your room key. You have room 206. The porter will take you luggage up to your room. Is there anything else you would like?” Sarah: “No. Thank you very much.” Vocabulary Focus

accommodation – a room in a hotel where travellers can sleep

to check in – to register at a hotel

56

hostel – an inexpensive place for young travellers to stay overnight, also named “youth hostel”

chalet – a small house often in a group of similar houses where people go for vacations

available – present and ready for use; at hand; accessible

to book (in) – to make a reservation British : to register in a hotel

booked up – if a hotel was booked up, all the rooms have already been taken

to check in – to arrive at and be given a room in (a hotel, motel, etc.)

to fill in / Am. fill out – to complete (a document) by providing necessary information

porter – a person whose job is to carry bags or luggage at a hotel, airport, etc.

Vocabulary Practice

1. Answer the questions: a. What is a hotel? What types of hotels can you mention? b. What are the differences between a cheap hotel and a luxurious hotel? c. What other types of accommodation can you mention? d. What are the advantages of staying in a hotel as compared to staying in a tent? e. Enumerate some people of the hotel staff and say what are they in charge with. f. Are facilities such as central heating or air conditioning important when choosing your accommodation?

2. Fill in the sentences with the following words:

accommodation, luxurious, on premises, checked in, lounge, amenities, booked up, en-suite bedroom

a. The hotel has other ….......... such as a restaurant, swimming pool, and exercise room. b. The hotel has a restaurant ................ c. They weren't sure if they could provide food and .................... for the whole group. d. They can afford now a holiday to a ............... hotel. e. The tourist arrived at the hotel, went to the reception desk and ................. f. The comfortable armchairs of the hotel ................ invite you to relax and dream away. g. I want to book a double room at your hotel with .................... facilities. h. The hotel was all .................. for the week.

3. Find the correct word for each column:

verb noun adjective to accommodate

booking available

to travel reception

57

facile 4. Cross out the odd word from each series:

a. hotel, hostel, motel, inn, chalet, store, camp site b. arrive, check out, come, turn up, show up, reach c. concierge, chambermaid, receptionist, tourist, doorman d. double room, single room, bedroom, en-suite room, twin room e. cheque, tip, gratuity, money, cash, change, coin f. charge, price, tax, prize, tariff, attendance, rate g. beforehand, reserve, book, cancel, bespeak, register

5. Match the words and make up sentences with the expressions: 1) to book a) a form 2) to fill in b) a porter 3) to tip c) in a double room 4) to stay d) a bill 5) to check in e) dinner at 6 6) to make f) a reservation 7) to pay g) at reception 8) to serve h) a single room GRAMMAR FOCUS PRESENT PERFECT CONTINUOUS

Affirmative Negative Interrogative

S + have / has + been + V-ing

S + have not/haven’t/ has not/hasn’t+ been +V-ing

Have / Has + S + been + V-ing?

I/you/we/they have been living in a hotel.

He/She/It has been filling in the form.

I/you/he/she/we/you/they have not (haven’t) living in a hotel.

He/She/It has not (hasn’t) been filling in the form.

Have I/you/ we/you/they been living in a hotel?

Has he/she/it/ been filling in the form?

Uses: Examples:

1. to show that something started in the past and has continued up until now

They have been talking for the last hour. I’ve been looking for affordable accommodation.

2. to talk about an action that started in the past and stopped recently

Why is the grass wet? Has it been raining? You seem tired. Have you been exercising?

Time expressions: for, since, how long…?, lately, recently, all day/morning/month, etc.

Note: with the verbs live, work, teach and feel we can use the present perfect or the present perfect continuous with no difference in meaning. Example: He has lived/has been living in London for the last five years.

58

GRAMMAR PRACTICE

6. Choose the best option between present perfect simple or present perfect continuous: a. At last! I’ve solved / been solving the problem. b. Jack has been trying / tried to get this book published for ages but so far no one has

said “Yes”. c. So, what have you done / been doing recently? Anything interesting? d. My friend has been buying / bought a new car. It looks great. e. I’ve never believed / been believing in ghosts or witches or fairies. f. You look well. Have you been taking / taken more exercises recently? g. The children are tired because they’ve played / been playing all day. h. Have you swum / been swimming? Your hair looks wet. i. Fantastic news! They’ve been agreeing / agreed to buy the house. j. Oh, There you are! I’ve looked / been looking for you everywhere.

7. Find the correct sentence in each pair: a. You’re so thirsty! What have you been doing? b. You’re so thirsty! What have you done? a. I’ve never understood maths. b. I’ve never been understanding maths. a. He is tired because he has run. b. He is tired because he has been running. a. I’ve been walking ten kilometres. b. I’ve walked ten kilometres. a. Sorry I’m late. How long have you waited? b. Sorry I’m late. How long have you been waiting?

8. Complete the dialogue. Use the correct form of the verbs in brackets. If two forms are possible, write both:

Sarah: “Wow, it ………………… (be) very busy in the shop this morning, hasn’t it?” Kim: “Yes. It …………… (put) new stock on the shelves since I got here. There …………

(not/be) a quite period at all. The phone in the office ……… (ring) every two minutes, so I …………… (try) to answer all the emails that the customer services department ……… (send) me!”

Sarah: “Yes I know how you feel. It’s incredible! I ………… (write) replies to twenty emails. And I ……… (serve) all the customers that ………… (come) in today.”

9. Translate into English: a. El caută de două săptămâni un hotel de cinci stele cu vedere la mare. b. El completează acest formular de cinci minute şi nu a terminat încă. c. De cât timp aştepŃi la recepŃie? Aştept de un sfert de oră. d. Camerista face curat de când oaspeŃii au predat camerele. e. De când încerci să faci rezervare la această pensiune? Încerc să fac o rezervare de o săptămână. f. Ai studiat ultima ofertă la acest hotel de lux de pe Coasta de Azur? g. Plouă de două zile, iar eu îmi petrec timpul la piscina din interiorul hotelului unde sunt cazat.

59

h. Hotelul meu preferat era rezervat în totalitate, aşa că a trebuit să chem un taxi şi să caut cazare în altă parte. WRITING FOCUS

10. Read the following fax message written to book a room. Pay attention to the information provided and write a similar message.

FAX TRANSMISSION To: The Metropolis Hotel Fax no: 023 543 234 In the attention of: The receptionist From: David Middleton Fax no: 023 889 232 Date: 2nd March 2011 MESSAGE I would like to book a room at your hotel. My wife and I will arrive on 10th May and leave on 16th May. We would like to book a non-smoking, en-suite room, with a balcony. Do you have any available rooms? Could you please let me know the price per room? Thank you.

SPEAKING FOCUS

11. a. Tim has already come back from his vacation. He was disappointed with the hotel services such as small rooms, noisy guests, terrible food, being overcharged. What should you advise him to do in order to repair the damage of his holiday?

b. What is your impression about mobile homes? c. What types of accommodation do you generally choose when you travel abroad or in your country? Motivate your choice.

60

Unit 9Unit 9Unit 9Unit 9

TTRRAAVVEELLLLIINNGG

People like to travel to different places around the world. The term travelling refers to the movement of one or more persons from one geographical location to another.

Travelling had no bounds in the old days. People could travel freely from one part of the world to the other end. Now to cross the borders and to travel to certain foreign countries you need the authorization of that country, named visa. When travelling, the person must also have a passport, which is issued from the traveller’s homeland. The visa is stamped in the passport. But you must keep in mind that there are no longer any frontier controls at the borders between the EU countries. You will therefore need to present a valid passport or ID card when travelling to the non-Schengen countries and when entering or leaving the EU at the external borders.

Travelling could be done for different purposes: some people travel for pleasure, others travel for education, health treatment, jobs, etc. Travelling may also include staying in a place for a day or more. Some people prefer conducted tours in which case they have to apply to a travel agency. Other travellers are interested in organizing their own journeys and choosing their own route.

The terms recreation, tourism, holiday travel, volunteer travel, migration, business trips are all incorporated in the term travelling. People can travel by various means of transport. Planes, buses, cars, trains, bicycles, ships are the main and the most used ones.

Every country has a network of railways, airlines or highways. A small sum of money is required to go from one corner of the country to the other. Driving a car in a city can be a difficult job when you think to all the street jams, the numberless pedestrian crossings, impossible parking, blocked crossroads, countless traffic lights, never-ending constructions. To avoid all these you can travel by underground which has a cheap and efficient public transport network system. If your business is more urgent, you can travel by plane. A plane will need only a couple of hours to fly round the whole world. Flying is no longer luxury transportation; today airlines give everyone the possibility to fly by offering attractive flight costs to and from different destinations. Aircrafts land and take off at the right time. Travelling by sea has also become more comfortable, swift and secure than before. Going on a cruise is a choice usually made by rich people.

Finally, it can be said that travelling is a very interesting activity of human life, sometimes considered even a hobby for some people. Besides pleasure, travelling also introduces a new country to the travellers. People can learn about the different lifestyles, customs or people in another country. Education, health and trade are also very popular forms of travelling in today’s world.

Checking in at the airport - Conversation Tourist: “Good morning. My flight is BA893.” Clerk: “I need your passport and your ticket, please.“ Tourist: “There you go.” Clerk: “Thank you. Do you have any luggage to check in, sir?” Tourist: “Yes, I have two suitcases.”

61

Clerk: “Could you put them on the weighing machine, please.” Tourist: “Sure. I don't think my baggage exceeds the allowed weight.” Clerk: “No. That's fine. Would you like a window or an aisle seat?” Tourist: “A window seat, please.” Clerk: “Here are your luggage tags and your boarding card. Your seat is 39C.” Tourist: “Thank you. What is the boarding time?” Clerk: “The plane is boarding in 30 minutes. You leave from Gate 15. Have a good flight!” Tourist: “Thank you. Goodbye.”

Vocabulary Focus

conducted tours – an organized journey in different parts of a country, region

homeland – the country where someone was born or grew up

travel agency – a business that helps to make arrangements for people who travel

underground / tube/ Am. subway –trains that run below the ground in a large city

journey – an act of travelling from one place to another

crossroad – a place where two or more roads cross

border – a line separating one country or state from another

to stamp – to attach a postage stamp to (something)

Vocabulary Practice

1. Answer the following questions: a. What documents do you usually need to travel to another country? b. Why do people like travelling? c. What means of transport are used nowadays? d. What are the advantages of travelling by car/bus/train/tube/ship/bike? e. What are the differences between a tour and a trip? f. What is the most interesting city to visit in your country? g. What is the most interesting souvenir that you have ever bought on one of your holidays?

2. Find definitions for the following means of transport:

1. subway a. a connected series of vehicles that move along a rail track

2. coach b. a vehicle that runs on rails and used to carry people on a short distance

3. train c. a large boat used for travelling long distances over the sea

4. van d. a system of underground trains in a city

5. truck e. a small vehicle that is used for travelling on water

7. taxi f. a vehicle with wings and engine that carries people or things in the air

8. motorcycle g. a very large, heavy vehicle that is used to move large or numerous objects

9. boat h. a large bus with comfortable seating that is used for long trips

10. plane i. a big vehicle, shaped like a box, with doors and windows at the back and sides, used for transporting people

62

11. tram j. a car that carries passengers in the city from one place to another for an amount of money that is based on the distance travelled

12. ship k. a vehicle with two wheels that is powered by a motor and that can carry one or two persons

3. Choose the right word and fill in the blanks below: luggage, flights, embark, depart, take off, platform, land, delayed, one-way, journey

a. We will travel from Spain to France by plane. The plane will...........at 10 am and will ...............at 11:00 am in Paris b. The train for Cambridge will............from ..................number 9. c. Anne and Joe will travel by sea. They will.................at Liverpool for New York. d. I'd love to go on a long................ e. All..............to New York today are.......................because of bad weather. f. How much is a.................ticket to New York? g. We had to pay extra for our excess.....................

4. Make up a dialogue using the following expressions:

Asking about direction Giving directions

• How can I get to ... from here? • How can I get to...? • Can you show me the way to...? • Can you tell me how to get to? • Where is...? • What’s the best way to get to....?

• Go straight on • Turn right/left • Take the first (turning) to the left/right • Go past the restaurant/school... • The ... is beside/in front of/next to...the....

5. Traveller’s Tips

a. Join the items from the two columns with in case or so that to form sentences, as in the example below:

1. Be careful in crowded areas or at night… 2. Let you family know your travel plans… 3. Take your travel insurance… 4. Find out the local address of your country’s embassy or consulate… 5. Make photocopies of your tickets and passports…

a. they/get in touch with you/emergency b. they/ be replaced/more easily if lost c. something serious/go wrong at/ destination d. any of your belongings/be lost or stolen e. there/be pickpockets or muggers about

Example: Be careful in crowded areas or at night in case there are pickpockets or muggers about.

b. In pairs, think of other traveller’s tips and write them down giving a reason.

63

GRAMMAR FOCUS PAST TENSE SIMPLE

Affirmative Negative Interrogative

S + V-ed1 /(V2) S + did not / didn’t + V Did + S + verb?

I/you/he/she/it we/you/they finished

I/you/he/she/we/you/they did not (didn’t) finish/come

Did I/you/he/she/it/ we/you/they finish/come?

Uses Examples

1. to express an action that occurred at a definite time in the past

The postman delivered the parcel at 8 o’clock yesterday morning.

2. to denote actions that happened immediately after one another in the past

She bought the tickets and went to the theater.

3. to express habits or states which are now finished

Mr. Jones worked in a factory when he was younger.

5. used to can also be used to habits / repeated actions in the past

He used to visit us every month when we were kids.

Time expressions: yesterday, then, when, last night/week/month/year/Friday/October, how long ago…?, three days/weeks etc. ago, in 1999 etc.

Note: the verb “to be” does not take the auxiliary verb ”did” in the interrogative or negative. Examples: She was happy. I wasn’t happy. Were you happy?

1 – Regular verbs form the past simple adding the –ed to the infinitive.

GRAMMAR PRACTICE

6. Put in the verbs in brackets into the gaps. Use the past tense simple. Pay attention to the punctuation when forming questions or sentences.

Example: …….she……to Spain last summer? (to travel) Did she travel to Spain last summer?

a. I……… my Maths homework yesterday. (to do) b. …….. Susan……… to England by plane? (to go) c. They ………. a medieval castle two weeks ago. (to visit) d. Jenny and Peggy ………… their brother. (not/to help) e. The children ……….. at home last weekend. (not/to be) f. When ……….you……… this wonderful skirt. (to buy) g. My cousin …………… into the van. (not/to crash) h. The boys ……….. the fenders of their bicycles. (to take off) i. ……….. you ……….. your aunt last week? (to phone) j. He ……….. to the office yesterday. (not/to drive)

7. Ask questions using the past tense simple: 1. you / your car / drive fast / in Germany

64

2. she / a car belt / wear 3. you / by train / travel / last year 4. he / a car / want to buy 5. we / on the sea / sail 6. Eric / his homework / forget to do 7. Jamie / all the races / win 8. the police / you / stop 9. the plane passengers / panic 10. she / by bus / in the city / go

8. Grand Canyon National Park The Grand Canyon is one of the most spectacular natural features on earth. It is listed

as one of the Seven Natural Wonders and became a United States National Park in 1919. The park covers an area of nearly 5,000 km².

Carved by the Colorado River, the Grand Canyon slices deep into the Colorado Plateau and forms one of the most impressive landscapes in the world. Up to 1963, when the Glen Canyon Dam was built, the Colorado river moved 143 million tons of stones each year.

Put the verbs into the correct form (past tense simple or present perfect simple): a. My friends (visit)………….. the Grand Canyon National Park last year. b. I (be / never) …………….to the Grand Canyon National Park. c. But I (see) ……………..lots of wonderful pictures. d. And yesterday I (buy)……………..a book about the Grand Canyon. e. I already (read) …………….. 30 pages about the Grand Canyon. It's really interesting.

9. Past tense simple or present perfect simple? Find and correct the mistake in each sentence:

a. Didn’t you do your homework yet? b. Pete’s been to the shops. He’ll be back soon. c. Did you ever eat snails? d. We’re here since ten o’clock. e. No one’s seen Lucky since three weeks. f. I had a headache since I woke up this morning. g. Have you called John yesterday? h. A plane just crashed over the Alps. More details follow later. i. When I was a child, I have ridden my bike to school. j. I have never met my grandmother. She died before I was born.

10. Translate the following sentences into English: a. În trecut, era mai periculos şi mai palpitant să călătoreşti. b. Ieri am făcut autostopul deoarece mă grăbeam şi nu am vrut să întârzii la şedinŃă. c. Anul trecut, de Paşte, am fost în Spania şi a plouat în fiecare zi timp de două săptămâni. d. N-am vrut să-mi petrec concediul în străinătate din cauza mâncării ciudate şi a problemelor de limbă. e. Prima linie de metrou din Londra, care a folosit locomotiva cu abur, a fost deschisă pe 10 ianuarie 1863, iar prima linie electrică, numită „tube” a fost pusă în funcŃiune în 1890. f. Săptămâna trecută am mers cu autobuzul şi ne-am blocat în traficul aglomerat la orele de vârf. g. Am

65

mers în Groenlanda când eram student şi am fost impresionat de plimbarea cu sania trasă de câini. h. Acum două zile am mers pe jos până în centru şi m-am simŃit foarte bine după o asemenea mişcare. i. Când eram student obişnuiam să călătoresc atât prin Ńară cât şi în străinătate. j. Acelaşi lucru mi s-a întâmplat şi mie când am ajuns prima dată la Paris. WRITING FOCUS

11. Find the noun which goes with the adjectives, then use them to write a composition to describe the place where you spent your holidays last year.

a. clean, sandy, dirty, secluded b e a c h. b. trendy, expensive, second-hand, souvenir s _ _ _. c. narrow, busy, winding, cobbled s _ _ _ _ _ . d. luxury, family, five-star, Victorian h _ _ _ _. e. delicious, local, gourmet c _ _ _ _ _ _. f. rocky, snow-capped m _ _ _ _ _ _ _. g. exotic, tropical, desert i _ _ _ _ _.

Last year I went to…. . It was great. I spent most of my days ….

SPEAKING FOCUS

12. Debate on the following topics: a. What are the most popular holiday destinations for people in your country? b. What is the most convenient means of transport for a successful trip? c. What do you advise people to do when they are on holiday and the weather is terrible? d. Think of some places that you have never visited before and that you would really like

to see. Ask questions about them. e. Mention some unpleasant holiday experiences and the way you solved them. f. Look at the following destinations and choose the most appropriate for you (motivate

your choice): a deserted beach/Tokyo/a mountain resort/a historical city/Thailand/Venice.

66

Unit 10Unit 10Unit 10Unit 10

BBAANNKKIINNGG SSEERRVVIICCEESS

Finance is the essence of trade, commerce and industry. Nowadays, banks play an

important role in modern business. The financial and industrial development of any country depends on the banking system.

The term “bank” is derived from the French word “banco” which means a ”bench” or ”money exchange table”. In old times, European money lenders or money changers used to display coins of different countries in big quantities on benches or tables for the purpose of lending or exchanging.

Today a bank is a financial institution which deals with deposits and accounts and many other financial services. It receives money from those who want to save in the form of deposits and it lends money to those who need it. Banks offer many services to attract a loyal clientele: to apply for a credit card or for a loan, to cash a cheque, to deposit or to exchange money, to open a checking account or a savings account, to transfer money, etc.

The idea is that any bank deals with other people's money. It accepts money from the people in the form of deposits which are usually repayable on demand or after the expiry of a fixed period. It provides interest and it gives safety to the deposits of its customers.

The bank also lends out money in the form of loans to those who require it for different purposes: to start a business, to buy a property, to purchase various domestic appliances, etc. They also provide other services such as safe deposit boxes, money orders, traveller's cheques, and so on.

No matter where we live, opening a bank account is one essential part of our life. We need a bank account to make our monthly payments, to transfer money or to deposit it.

Checking accounts are just the beginning of the services. They come with a variety of options from ATM and debit cards, direct deposits, unlimited cheque writing and various methods of overdraft protections.

Banks own and operate ATM networks that provide convenient access to cash. With the large network of automated teller machines or ATMs available, you are never very far from your money. They can be found in most busy streets and shopping areas.

For those persons who are on the go, banks today offer online/Internet or mobile banking. Many services are available over the computer or telephone, making it easy to cheque balances, make online bill payments and balance your cheque book.

Some banks also offer information and help their customers invest their money.

Vocabulary Focus

savings (pl.) – the amount of money that you have saved especially in a bank over a period of time

loan – an amount of money that is given to someone for a period of time with a promise that it will be paid back

available – present or ready for use chequebook/checkbook – a book that

67

contains blank cheques issued by a bank

checking account – a type of deposit account held at a financial institution that allows for withdrawals and deposits

overdraft – an amount of money that is spent by someone using a bank account that is more than the amount available in the respective account

money order - an order issued by a post office or bank, for payment of a specified sum of money

bill – a written document that specifies the cost of goods sold, services performed, or work done

cash - ready money exchange - funds payable either in a foreign currency or in domestic currency

Vocabulary Practice

1. Answer the following questions: a. What is a bank? b. What are the main services provided by a bank to its customers? c. What banking services do you personally take advantage of? d. What do the ATM networks provide? e. What are savings accounts? f. What is the online or mobile banking? g. Comment on: “A bank is a place where they lend you an umbrella in fair weather and ask for it back when it begins to rain.” h. Would you suggest any significant changes in the banking industry?

2. Match the banking terms with their appropriate definitions:

1. mortgage a. money lent by a bank etc and that must be repaid with interest

2. bank loan b. to draw beyond one’s credit

3. overdraft c. a bank account held in the names of two or more people, often husband and wife

4. joint account d. a record of transactions in a bank account

5. interest e. a type of bank account on which interest is paid

6. traveller’s cheque f. deficit in a bank account caused by withdrawing more money than is paid in

7. current account g. money paid for the use of money lent

8. overdraw h. a bank account from which money may be drawn at any time

9. deposit account i. a legal agreement in which a person borrows money to buy property (such as a house) and pays back the money over a period of years

10. statement j. a cheque issued by a bank to a traveller to enable him to

68

obtain foreign currency when he is abroad

3. Give adjectives corresponding to the following nouns: payment, negotiation, safety, bank, commerce, finance, transaction, loyalty.

4. Fill in the blanks with prepositions:

a. The cheque provides an easy and cheap means … remitting money. b. Some banks make insurance and investment services available … their customers. c. Banks own and operate ATM networks that provide convenient access … cash. d. Anyone may open a checking account… providing proof of identity and a specimen signature. e. ATMs are to be found … most busy streets and shopping areas. f. A bank is a financial institution that serves … a financial intermediary. g. You must have a current account, or certain types of savings accounts to pay … cheque. h. The cheque is made payable (written) … the order of the beneficiary. i. The account holder is responsible … keeping sufficient funds to cover all cheques

written against the account.

5. Choose the right word to finish the sentences:

1) Ben and Jen needed money to redecorate their home, so they asked a loan officer if they qualified for a ......... instead of a second mortgage on their house.

a. deposit slip b. Iine of credit c. debit card d. bill 2) Nowadays, bank customers have more options. For example, they can pay their bills

over the telephone or they can pay them .......... a. online b. over the phone c. with a safety deposit box d. with a bank retailer

3) Some people rent a ......... in order to keep important papers and items safe. a. deposit slip b. safety deposit box c. debit card d. bank statement

4) Almost all customers have a(n) ......... card so they don't have to go into the bank to withdraw money. They can also use their cards to purchase goods in stores.

a. export b. debit c. withdrawal d. loan 5) Laurie has two accounts. She can ......... funds from her checking account into her

savings account right over the phone. a. loan b. order c. transfer d. rent

6) Every month, Kevin ......... his bank statement in order to balance his chequebook. a. fills out b. exchanges c. withdraws d. reviews

7) Mary has an appointment with a loan ......... because she wants to buy a new car and needs $3000 to complete the purchase.

a. teller b. secretary c. taker d. officer 8) Karen learned how to… her chequebook at an early age.

a. balance b. pay-off c. exchange d. withdraw 9) Rose and Tom want to obtain the bank approval for a… because they want to buy a house

this year. a. check b. safety deposit box c. mortgage d. savings account

10) Normally, people get ......... for a mortgage before they go house hunting so they know what kind of house they can afford to buy.

69

a. pre-approved b. withdrawal slips c. an order d. traveller's cheques GRAMMAR FOCUS

PAST CONTINUOUS TENSE

Affirmative Negative Interrogative

S + was/were + V-ing S + was not/wasn’t + V-ing S + were not/weren’t + V-ing

Was/Were + S + V-ing?

I/ he/she was going to the bank.

We/you/they were talking about interest rates.

I/he/she wasn’t going to the bank.

We/you/were not /weren’t talking about interest rates.

Was I/ he/she/ going to the bank?

Were we/you/they talking about interest rates?

Uses Examples

1. for an action which was in progress when another action interrupted it

We were playing football in the garden when it started to rain.

2. for two or more simultaneous actions in the past

I was cooking dinner while Marry was watching TV.

3. for an action which was in progress at a stated time in the past

At 10 o’clock last night I was driving back home from the party.

5. to describe the atmosphere, setting etc. and to give background information to a story

The birds were singing and the sun was shining when something strange happened...

Time expressions: while, when as, all morning/evening/week, etc.

Note: When there are two past continuous forms in a sentence with the same subject we can avoid repetition by just using the present participle (-ing form) and leave out the verb to be. Example: He was walking along, he was singing a song. → He was walking along, singing a song.

GRAMMAR PRACTICE 6. Yesterday at 3 p.m. the following people were in the middle of an action. Write positive sentences using the verbs in the past tense continuous:

a. You / play / cards b. Alice / walk / around the lake c. Caron / listen / to the radio d. We / read / a book about Australia e. Linda / look for / her ring f. Fiona and Sam / visit / the castle g. Ben / wash / the car h. Kim and I / wait / in the park i. Helen / cook / dinner j. Greg and Phil / count / their money

70

7. Put the verbs in the past tense continuous: a. When I phoned my friends, they (play) …. monopoly. b. Yesterday at six I (prepare) …. dinner. c. The kids (play) …. in the garden when it suddenly began to rain. d. I (practise) …. the guitar when he came home. e. We (not / cycle) …. all day. f. While Aaron (work) …. in his room, his friends (swim) …. in the pool. g. I tried to tell them the truth but they (listen / not) …. . h. What (you / do) …. yesterday? i. Most of the time we (sit) …. in the park.

8. Ask for information about the bold part of each sentence: a. Henry was living in London last year. b. Anita was working at a restaurant last week. c. Ricky was waiting for Polly. d. Sarah was singing a song. e. Joe was reading a book. f. At six o'clock, Mary and her family were having dinner. g. Bob was walking home because his car had a flat tire. h. At half past seven, Mr Logan was driving home. i. The children were playing in the sandbox. j. Claire was visiting her best friend.

9. Translate into English: a. Bancomatele dau acum posibilitatea efectuării celor mai uzuale operaŃiuni, precum retrageri şi transferuri. b. Deschideam un cont de economii la această sucursală când mi-a sunat telefonul mobil. c. Aş putea să comand un carnet de cecuri, vă rog? d. La ora 13 el completa un formular pentru un cont curent. e. Ieri pe vremea aceasta îmi aşteptam soŃia pentru a depune nişte bani în contul nostru. f. În timp ce eu completam un cec pentru achitarea mărfii, colegul meu îi făcea recepŃia. g. Se gândea să-şi ia un cec de călătorie deoarece reprezintă una din metodele cele mai sigure de a transporta bani în străinătate. h. Primeam un raport al băncii în fiecare lună, dar m-am hotărât să-mi retrag toŃi banii şi să-i investesc în imobiliare. WRITING FOCUS

10. Make up a dialogue asking and giving information about bank services. SPEAKING FOCUS

11. Choose one of these questions to discuss: a. Can you name any major foreign banks where one could open an account? b. How do banks make their money? c. What recent banking developments can you mention?

71

UniUniUniUnit 11 t 11 t 11 t 11

BBUUSSIINNEESSSS CCOOMMMMUUNNIICCAATTIIOONN

From a smile and a wave to a message on the Internet, communication keeps us in

touch with the rest of the world. It is a process of sharing facts, ideas, opinions, thoughts and information through speech, writing, gestures or symbols between two or more persons.

Imagine that you have a company and you begin a day's work with a brief meeting with your employees. Later on that day, you study some visual graphs of production rates of the past two weeks. After lunch, you get an e-mail regarding a complaint from a customer saying that the product isn’t working properly, so then, you notify your employees and explain the case after apologizing to the customer about the inconvenience. By the end of the day a shipment has finally arrived, containing parts that you have waited for to finish assembling your product, and you notify your employees once again so they can begin preparing. Finally at the end of the day, you receive a call; it turns out to be a customer who is interested in buying your product. What you practically did for a day’s work was communicating, beginning with the brief meeting you had with your employees to the customer you spoke on the phone at the end of the day.

The way you communicated in business was important, because you had to change the customer’s negative attitude into a positive attitude and satisfy the customer’s needs. Your communication skills made the customer feel more relaxed, giving you the opportunity to fix the problem. Consequently, if you have good communication skills you will always end with great results.

Today’s technology has significantly changed the methods used to communicate in business. Emailing and faxing have become very popular methods to communicate in business. But the more traditional communication methods still have an important place in most businesses.

Verbal communication in groups and between individuals is still a popular method of business communication. Mastering the art of verbal communication can help you communicate ideas and solve problems in ways that everyone understands.

Phone communication remains an important means of business communication because it can link partners, employees and business professionals nationally and globally. Costs of phone communication can be significant, especially if the business requires a lot of international calls.

The Internet and social media Web-based portals, such as Facebook and Twitter, represent ways for businesses to communicate important information in a matter of seconds.

Faxing is a fast way to communicate information and data as well. Faxing can be especially beneficial when information needs to be communicated in hard copy.

Written communication is another important method of communication because it helps establish a paper trail. Believe it or not, companies still write memos and other reports that communicate information internally throughout a company.

Non-verbal communication is also used in business more often than we realise. When your manager reads your report, he may not need to say anything to show you how

72

he feels. The way he holds the report and the look on his face immediately tells you if he is delighted, surprised, disappointed or angry.

Many aspects of communication come down to not ”what” is said but ”how” it is said. In fact, facial expressions and gestures have always been a powerful way of communicating and many expressions have the same meaning all over the world. For example, people smile when they are happy or frown when they are sad. Equally, showing your open hands is widely recognised as a sign of peace, while raising your fist can be a sign of anger or aggression. However, some gestures may have different meanings in different places. A friendly sign in one culture might be impolite in another - so take care!

Another way of showing your feelings is through touch or sounds that aren't words. Sighs can show that you are bored, while laughter usually tells people that you are amused. Handshakes, kisses and hugs are different ways of greeting people or signs of affection and love.

On the other hand, what we wear can also communicate something about us. Business people usually wear expensive suits in order to appear serious, people in the entertainment industry wear glamorous outfits, and teenagers might wear designer jeans and pierce their noses. So when you meet someone for the first time, remember, it's not just what you say that makes an impression, but also what you wear and what you do! Vocabulary Focus

graph – an abstract representation of a set of objects

to notify – to make known openly or publicly

complaint – a feeling or declaration of disapproval

memo – a message on paper from one person or group

properly – in an adequate manner suitable for the occasion or purpose

to master – to acquire complete knowledge, understanding, or skill in

shipment – transportation of goods and cargo, by land, air, and sea

hard copy – a permanent reproduction or copy on paper of any transmitted data

inconvenience – something that is a source of irritation

paper trail – the written evidence of someone's activities

to assemble – to form by putting together parts or materials

to pierce – to make a hole or series of holes, to puncture

Vocabulary Practice

1. Answer the questions: 1. What is the importance of communication in business? 2. What methods of business communication can you mention? 3. What positive examples of business communication can you mention? 4. What negative examples of business communication can you mention? 5. Enumerate some types of non-verbal communication. 6. How can a person’s body language affect communication?

73

7. Do you consider that facial expressions, gestures, eye contact, posture, or the tone of your voice can help you communicate in business?

8. Comment on: ”Managerial communication sets the company’s direction and builds professional relationships that ultimately determine the performance culture of the workplace”.

2. a. Write the word family of the verb to communicate.

b. Give the corresponding nouns to the following verbs:

Verb Noun Verb Noun to communicate to produce to express to speak to complain to master to report to meet to ship to transmit

c. Find synonyms for:

Word Synonym 1. relaxed 2. to notify 3. customer 4. to communicate 5. globally 6. to change 7. glamorous 8. to meet

d. Match the expressions 1 – 5 with their meanings a – e.

1. to keep in touch a. to change something for a specific purpose 2. is widely recognized b. to threaten someone or something 3. take care c. think about what you are doing 4. specially adapted d. accepted around the world 5. to warn off e. to stay in contact with someone

3. Fill in the blanks with the following words and then translate the text into Romanian. time, help, talking, many, read, essential, about, intimidating, crucial

Tips to Improve Verbal Communication Verbal communication skills are ….. in today’s business environment – both

formally and informally. The following tips ….. you think about how you can improve your verbal communications skills, whether in planned or unplanned situations.

74

1. Read more. Simply increasing what you ….. (business texts, novels, newspapers, etc) can improve your vocabulary and help you express your ideas more clearly.

2. Think about the words. Too ….. words will bore your listener, take up too much time and result in losing credibility. You must not use words that people don’t understand as you may appear ….. and make them feel inferior.

3. Listen and be interested. Listening more and ….. less means you understand your partner and bring him into the conversation. This also means showing respect to the other party.

4. Use examples. If you’re speaking ….. a business matter, use facts, hypothetical situations or company history to clarify or illustrate your statements.

5. Think before you react. How you phrase your words is a ….. aspect of business relationships. Therefore, take the….. to carefully build your language. 4. Match the terms to their definitions:

1. telegram a. the method of exchanging digital messages on the Internet 2. mobile phone b. telephonic transmission of scanned printed material (both text

and images)

3. fax c. a mobile electronic device used to make telephone calls

4. voice mail d. a message sent over a telegraph

5. e-mail e. a computer based system that allows users and subscribers to exchange personal voice messages

5. Say if the following sentences are true or false: a. Sharing or exchanging information and ideas between persons means communication.

º True º False b. The process of communication may not always contain a message.

º True º False c. Feedback is one of the elements of the process of communication.

º True º False d. A traffic policeman showing a stop sign is a process of communication.

º True º False e. Communication with the help of words is known as non-verbal communication.

º True º False f. Verbal communication may be oral or written.

º True º False g. There are various ways through which we communicate our message. These are

called types of communication. º True º False

h. Telegrams, faxes or e-mails are means of communication normally used to send urgent messages. º True º False

75

GRAMMAR FOCUS

PAST PERFECT SIMPLE

Affirmative Negative Interrogative

S + had+ V3 S + had not / hadn’t+ V3 Had + S + V3?

I/you/he/she/it /we/you/they had sent the message

I/you/he/she/we/you/they had not (hadn’t) sent the message

Had I/you/he/she/we/you/they sent the message?

76

Uses: Examples:

1. to express an action which happened before another past action or before a stated time in the past

Lucy had finished writing all her letters and emails by six o’clock. By the time I arrived in my office the boss had already left. The new secretary said that she had brought the papers.

2. to denote a past action that took place over a period of time

The production manager had been in the factory for 50 minutes. Pat had lived in London for 10 years. She had worked there since 2007 when I met her.

Time expressions: for, since, before, after, already, just, till/until, when, by the time, scarcely/hardly… when, no sooner…than, etc.

Note: The use of scarcely, hardly, no sooner in initial position generates inversion between the subject and the auxiliary. Examples: No sooner had they finished work than the manager called them back. Hardly / Scarcely had they returned from the U.S.A. when they were sent on a business trip to Portugal.

PAST PERFECT CONTINUOUS

Affirmative Negative Interrogative

S + had+ been +V-ing S + had not / hadn’t been+ V-ing Had + S + been+ V-ing?

I/you/he/she/it/we/you/they had been talking

I/you/he/she/we/you/they had not (hadn’t) been talking

Had I/you/he/she/it/we/you/they

been talking?

Uses: Examples:

1. to put emphasis on the duration of an action which started and finished in the past, before another action or stated time in the past

I have been walking for about half an hour when I realized I was out of town. By the time her mom arrived, she had been talking on the phone for 10 minutes.

2. to express an action which lasted for some time in the past and whose result was visible in the past

She had been swimming and her hair was still wet. We had been working and we were tired.

Time expressions: for, since, how long, before, until/till, by the time, etc.

GRAMMAR PRACTICE 6. Using the words in parentheses, complete the text below with the right forms of past perfect simple or past perfect continuous:

I'm sorry I left without you last night, but I told you to meet me early because the show started at 8:00. I ...................... (try) to get tickets for that play for months, and I didn't want to miss it. By the time I finally left the coffee shop where we were supposed to meet, I................. (have) five cups of coffee and I..................... (wait) over an hour. I had to leave because I...................... (arrange) to meet Kathy in front of the theater.

77

When I arrived at the theater, Kathy...........................(pick up, already) the tickets and she was waiting for us by the entrance. She was really angry because she..................... (wait) for more than half an hour. She said she................... (give up, almost) and.............. (go into) the theater without us. Kathy told me you.................. (be) late several times in the past and that she would not make plans with you again in the future. She mentioned that she..................... (miss) several movies because of your late arrivals. I think you owe her an apology. And, in the future, I strongly advise you to arrive on time! 7. Put the verbs in brackets in the correct tense (past perfect tense simple or paste tense simple):

a. After Alice............ (to spend) his holiday in England she............. (to want) to learn English. b. Morris.................(to phone) Dad at work before he...................(to leave) for his trip. c. Mary............. (to turn on) the radio after she.................... (to finish) her homework. d. When he.................. (to arrive) at the stadium the match................... (to start) already. e. My cousin................... (to live) in London before he...................(to move) to Rome. f. Before she............... (to paint) the portrait she....................... (to play) the piano. g. Mother................ (to watch) a movie after the children................... (to go) to bed. h. After Marc .............. (to prepare) dinner he.................. (to phone) his girlfriend. i. I.................... (to be) very tired because I........................ (to study) too much. j. They................ (to ride) their bikes before they.......................(to meet) their friends.

7. Rewrite the sentences using the words in brackets:

a. As soon as he went into the bank, one of the robbers attacked him. (No sooner…than) b. She fired him as soon as she was appointed manager. (Hardly…when) c. As soon as he stepped into his office, the cell phone rang. (No sooner…than) d. They read the text first. Immediately after that they answered the questions. (Hardly…when)

8. Underline the correct form in italics:

1. When she entered her flat she had found / found that someone had broken / broke in. 2. He had been driving / was driving home when / after he crashed into a tree. 3. When Laura arrived / had arrived at the restaurant, Tony had gone / had been gone home. 4. When / While I entered the room, they had just / yet finished their dinner. 5. After they had been living / lived there since / for two years they decided to build an

extension to their house. 6. While / After he had graduated from university, he joined / was joining the army. 7. She had been watching / watched TV since / when Tome came home. 8. She had never / ever been to South America before / after.

9. Translate into English using past perfect simple, past perfect continuous or past tense simple:

78

a. Mi-a părut rău că nu i-am împărtăşit gândurile mele. b. De îndată ce a terminat de scris e-mailul, l-a trimis tuturor prietenilor săi. c. El nu făcuse nimic înainte de a-mi cere sfatul în legătură cu mijloacele de comunicare pe care le putea folosi într-o asemenea situaŃie. d. Secretara mi-a spus că directorul vorbea la telefon de o jumătate de oră. e. Ei comunicaseră prin scrisori înainte să apară Internetul. f. Ieri pe vremea aceasta, Tom vorbea cu partenerii de afaceri de un sfert de oră. g. Când avusese probleme cu vocea, el folosise foarte mult limbajul non-verbal. h. Citisem mult despre comunicarea verbală înainte să scrie o lucrare despre aceasta. i. L-am întrebat dacă a expediat deja scrisoarea. j. Studiasem la universitate timp de 3 ani înainte de a începe să lucrez în această companie. WRITING FOCUS

10. Verbal communication is the essence of what most of us do in business - whether we are making a business plan, dealing with some difficult situations, revitalising a team, responding to complaints or creating an exceptional customer service climate. The essential actions taken by managers and staff happen through various types of communication. Provide some examples of bad communication and discuss upon the best improvement solutions. Write an essay on this topic.

SPEAKING FOCUS

11. a. Sending short text messages, talking over the phone, chatting on the internet; what is the importance of these means of communication in your everyday life? b. Do you consider that it is important to know how to interpret body language in order to predict other people's mood and thinking? Does body language (arms crossed, standing, sitting, relaxed, tense) send a message to the others? Give clear examples. c. Should universities often organize communication sessions to improve students’ communication skills?

d. Is text messaging language detrimental to the grammatical skills of youth culture? e. “Face to face communication is better than other types of communication such as

letters, emails or telephone calls.” Do you agree or disagree with this statement? f. What is your opinion about writing letters? Do you believe it is an old-fashioned

method to communicate? g. Express your opinion on the following statement: ”If communication is not effective,

coordination breaks down, relationships suffer, mistakes multiply and productivity decreases”.

79

Unit 12 Unit 12 Unit 12 Unit 12

HHIIGGHHEERR EEDDUUCCAATTIIOONN

On their first day at the University Campus in Porto, Portugal, three Erasmus

students meet as roommates for six months: Bill is from California, US, Will is from London, UK, and Andrei is from Piteşti, Romania – a student at “Constantin Brâncoveanu” University. The students introduce themselves, make themselves comfortable in their room and then they go out at the campus cafeteria to get to know each other a little bit better and to chat.

Andrei: “So, Bill, can you tell us a few things about the higher education system in the US, because I’d like to apply there for a scholarship in the future.”

Bill: “Well, in the US we have public and private education. Thus public universities are usually state-sponsored, while private schools are independent – their funding being ensured primarily by the tuition they charge and by sponsorship.”

Andrei: “From what I know post-secondary education in the US is known as college or university. Is there a difference between them?”

Bill: “Yes, there is. Universities are a group of colleges, meaning that when you go to university you will graduate from one (or more) of their colleges. So universities are bigger, better known and they also focus on research. Colleges offer degrees in one specific area, they have smaller classes, creating thus a more friendly learning environment for students and a better student-teacher interaction. Single colleges tend to be smaller, but they are a bit cheaper than universities.

Will: “In the UK higher education is provided by three main types of institutions: universities, colleges and institutions of higher education. All universities are autonomous institutions and most of them are divided into faculties which may be subdivided into departments.”

Andrei: “In Romania we have a similar system: universities are made up of faculties, which have in their turn specialized departments.

Will: “Bill, which are the most important criteria for admission to university?” Bill: “Well, in the US students usually apply for admission and the criteria involve the

rigor and grades obtained in high school. In addition, extra curricular activities, a personal essay and an interview are commonly used for college admission.”

Will: “In the UK the most common qualification for entry to higher education is the General Certificate of Secondary Education (GCSE) at ‘Advanced’ (A) level. After taking this exam (in which students usually take up to ten subjects), students may choose to continue their education at vocational or technical colleges, or at the university. I must say that A-level examinations are required for university entrance in the UK.”

Bill: “How about Romania? Which are the admission criteria in Romania?” Andrei: “Well, in our country the most important criterion is the Baccalaureate diploma

for which you have to take a final exam at the end of the four-year high school cycle, comprising two or three oral examinations and four or five written ones. Furthermore, Romanian private and state universities are independent and autonomous institutions, with

80

their own internal policies regarding admission, exams and graduation. Universities are also free to provide full-time education and part-time education or distance education for the students who work or want to get a job.”

Will: “Bill, can you tell us a little bit about the types of diplomas awarded at the end of your studies?”

Bill: “Four years of study lead to a Bachelor of Arts (BA), a Bachelor of Science (BS), or sometimes another type of bachelor’s degree.”

Will: “In the UK there are three university levels. The first level lasts three or four years and leads to a Bachelor’s degree and the second level is the Master’s degree which could be a Master of Arts (MA), Master of Business Administration (MBA) or other types. The third level is the Doctor of Philosophy, also known for short as D.Phil. or PhD. “

Andrei: “So, there are a lot of similarities but also differences between these three systems of higher education, with their positive and negative aspects, but the important thing is that they offer opportunities for study, for international student and teacher exchange, for different types of scholarships and international experiences.”

Will: “Yes, I agree. It’s vital to have the desire to learn more and to be open to new experiences and challenges – once-in-a-lifetime opportunities.” Vocabulary Focus

to apply (for) – to put in an application or request

emphasis – special importance or significance

scholarship – a grant of financial aid awarded to a student, as for the purpose of attending a college, or because of academic merit

vocational – of or relating to applied educational courses concerned with skills needed for an occupation, trade, or profession

tuition fee – a fee paid for instruction, especially for higher education

to award – to grant or to give especially as a reward for merit; to bestow, to confer

to pursue – to apply oneself to (one’s studies, hobbies, interests, etc.)

undergraduate – a college or university student who has not yet received a bachelor’s degree (undergrad)

Vocabulary Practice

1. Answer the following questions. a. What does higher education mean and which are the advantages of attending university? b. What types of higher education can you mention and what is the difference between them? c. What is the difference between a college and a university? d. Which are the general selection criteria for students who want to enrol to a university? e. How can a student obtain free tuition or a scholarship? f. What types of diplomas or degrees can you obtain after graduating each of the three

levels of higher education? g. Do you consider that students who enrol on a full-time basis must be obliged to

attend classes?

81

2. a. Find the word family of the verb to educate. b. Write nouns derived from the following verbs:

Verb Noun Verb Noun Verb Noun

to attend to study to enrol

to graduate to research to know

3. Match the following terms with their definitions.

a. credit 1. the time during which a school, college or university holds classes

b. teaching staff 2. teaching by giving a discourse on some subject, typically to a class

c. graduate student 3. a unit of academic work successfully completed; they vary depending on a particular course or difficulty of the subject

d. major 4. a discipline, a branch of knowledge

e. placement test 5. a type of test given to students in order to place them at a level of class most suited to their needs

f. undergraduate 6. the subject studied at a less concentrated level and in order to round out an education

g. academic year 7. a student who has entered studies for his Master’s or Doctoral degree

h. minor 8. professors or teachers who are employed at an educational institution

i. lecture 9. a student who must have a Bachelor’s degree before continuing in a graduate program for a Master’s degree or Doctorate degree

j. subject 10. the subject in which a student specializes and, usually, the area in which a student plans a career

4. Correct the following sentences using the expressions from the box below.

lecture; to resit an exam/to retake a failed exam; subject; to skip classes/lectures; to take an exam/to sit an exam/to do an exam; to be expelled from the university; to fail/miss an exam/to

do badly in an exam; teacher; to pass an exam/to do well in an exam; grade.

1. I can’t come out. I’m studying. I’m passing an exam tomorrow. 2. Congratulations! I know you managed your examination. 3. You can study various careers at this university. 4. I got good notes in my continuous assessment last semester. 5. She is a professor in a primary school. 6. He gave an interesting 60-minute conference on management. 7. There’s no problem if you fail the exam. You can pass it. 8. I like this subject so I never attend classes. 9. If I don’t take these exams I will be thrown out of the university. 10. I won’t get the scholarship this term because I passed my last exam.

82

GRAMMAR FOCUS

FUTURE TENSES Future Tense Simple

Affirmative Interrogative Negative

S + Shall/Will/’ll + V1 Shall/Will + S + V1? S + Shall not (shan’t) / Will not (won’t) + V1

I/we shall/will/’ll go You/he/she/it/they will/’ll go

Shall/Will I/we go? Will you he/she/it/they will/’ll go?

I/we shall not /will not go You/he/she/it/they will not go

Uses Examples

1. to talk about future events, to make predictions, assumptions, to make invitations, requests, decisions on the spot

Next August they will open a new branch of this university. Will you join us for lunch?

2. in type 1 conditional clauses (introduced by if, unless, in case, provided that, etc.) and time clauses (introduced by when, after, before, till, as soon as, etc.) we use no future, but present

I’ll call you if something goes wrong. We’ll write to you when we know the result of the test.

Time adverbs: tomorrow, the day after tomorrow, next week/month/year/etc., soon, in the (near) future, in two/three/etc. days’/months’/years’/etc. time, etc.

Future Tense Continuous

Affirmative Interrogative Negative

S + Shall/Will/’ll + Be + V-ing

Shall/Will + S +Be + V-ing? S + Shall not (shan’t) / Will not (won’t) + Be +V-ing

I/we shall/will be studying You/he/she/it/they will be studying

Shall/Will I/we be studying? Will you he/she/it/they will be studying?

I/we shall not /will not be studying You/he/she/it/they will not be studying

Uses Examples

1. to describe an activity in progress in the future or to say that something will definitely happen

Next year I’ll be studying in London. While I’m studying, you’ll be cooking dinner. Don’t cut the onions! You’ll be crying! This time tomorrow he’ll be taking his graduation exam.

Time adverbs: this time tomorrow/next Monday/next week/next month/etc., all day tomorrow/ next year/ etc., all week/month/year/etc.

Other Ways of Expressing Future

Be going to S + To Be(conjugated) + Going to + V1

It is used to make a connection between present and future, to express plans and intentions (things we have already decided to do) or to make predictions

We’re going to have lunch with the professor from New York. Be careful! That rock is going to fall! Look at the sky! It’s going to rain.

Be due to S + To Be(conjugated) + Due to + V1 He is due to name the new chief of the

83

It is used to express things we expect to happen.

company in a few days. We are to move in a new house soon.

Be about to S + To Be(conjugated) + About to + V1

It is used to express things that will or will not happen very soon .

Some people say that the place of development in technology is not about to slow down soon. I’m about to leave in five minutes.

Present tense simple

S + V1

It is used to talk about events in the future based on a fixed timetable, program, calendar etc.

Jim’s plane leaves London at 12 p.m. The academic year starts on October 1st.

Present tense continuous

S + To Be(conjugated) + V-ing

It is used to express things we have arranged to do in the future.

Ann is leaving tomorrow morning for London. I’m seeing my friend today at lunch.

GRAMMAR PRACTICE

5. Choose the best future tense form in the following sentences: a. Please don’t leave until I won’t come/come back. b. I’ll meet/be meeting the bank manager on Monday morning. c. While I am taking my exam, you’ll be thinking/think about me. d. This time next year I will study/will be studying for my admission exam at university. e. When she will come/comes back, let me know. f. Be careful! If you take one more step, you’ll fall/are going to fall. g. Shall/will you join us for dinner tonight? h. Tomorrow between five and seven Helen will study/will be studying the policy of

Erasmus scholarships. i. If I get a visa, I’ll go/I’m going to the US to apply for a state university.

6. Correct the mistakes in the following sentences: a. We were discussing your case tomorrow, so I’ll be able to give you an answer soon. b. You miss the class if you don’t hurry! c. We’ll go out if the weather will be fine. d. When you’ll receive the results of the test, please let me know. e. Tomorrow between six and eight they work on their project presentation. f. You’ll be able to speak English better if you’ll study more and come to classes. g. The plane to London leave at 3 a.m. and arrive at 5:30 on Monday. h. While we study they will be visit the park. i. He becomes the vice-president of the company this week. j. Shall you come with us on vacation?

7. Put the verbs in brackets in the right future tense: a. What we (do) ……… if we miss the plane? b. Private higher education (develop) …….. throughout the country soon. c. After the graduation ceremony we (go) ……… out to celebrate. d. I hope that the Romanian grading system (be) …….. similar to the one in the UK and

US in the future. e. I (apply) ………. for a private university after I graduate high school.

84

f. If I (study) ……. better, I (become) ………. a good student. g. I hope when we (come) ……… back the children (study) ……… for the exam. h. He (go) ……… to the library, he has a project to finish. i. This time next year our students (work) ……… as managers. j. She (become) ……… a PhD professor in management sciences next year.

8. Translate the following texts

A. into English: a. Sistemul de învăŃământ superior românesc este structurat pe 3 niveluri de studii universitare: studii universitare de licenŃă, studii de masterat şi studii doctorale. b. În învăŃământul superior nu sunt admise discriminări pe criterii de vârstă, naŃionalitate, etnie, sex, origine socială sau orientare politică. c. Majoritatea specialiştilor consideră că instituŃiile de învăŃământ superior au nevoie de o mai bună gestionare internă, considerând că parteneriatele cu diverse îintreprinderi şi concurenŃa vor consolida pozitia universităŃior. d. Cadrele didactice recunosc necesitatea unor standarde de calitate şi a unor etichete de calitate europene, iar majoritatea cred că mobilităŃile studenŃilor ar trebui să devină o parte obligatorie a programelor de studiu.

B. into Romanian: Graduates of American law schools are finding that their chosen career is less

lucrative than they had hoped. “The Apprentice”, a television show in which contestants compete for the privilege of

working for Donald Trump, presents 16 people who are down on their luck, having lost previous jobs or otherwise having to start all over again. No fewer than five of them are lawyers. The legal-job market in America remains blocked. But the numbers applying to law school are still soaring, and students are taking out ever bigger loans as tuition fees grow faster than lawyers’ salaries. Increasingly, they are graduating into a world of overblown expectation and debt.

Graduates’ chances in the job market have worsened since the “cleaning” of 2009, when firms laid off young lawyers and withdrew job offers. The National Law Journal says that the 250 biggest firms cut their numbers of attorneys by 4% in 2009 and were projected to cut by another 1.1% in 2010, making for the worst two-year period in the last 33 years.

WRITING FOCUS

9. a. Find information on the concept of home schooling and briefly present the main ideas in a summary and then state your opinion on this type of learning referring to its advantages and disadvantages.

b. Write some things that you would like to improve about the university where you study. c. Make a comparison between high school life and university life, referring to their

advantages and disadvantages.

85

SPEAKING FOCUS

10. Select and debate one or more of the following topics:

a. The final exam (baccalaureate) should or should not be eliminated. b. Admission to universities is or is not necessary and/or relevant. c. How should universities organize their exams in order to be more efficient both for

teachers and students? d. Which are the benefits of scholarships (for example Erasmus) for students? Would

you like to apply for one? e. Do you think that students who apply for an Erasmus scholarship improve their

academic information and intensify research in their field of study? f. Which are the main areas of the Romanian higher education system that should be

improved? How? g. How do you see the Romanian education system as compared to the foreign

ones? h. Comment on: “The world does not need gorgeous halls and rooms for its

development, but schools with competent teachers and free tuition for talented young disciples who are unable to pay the expense of study”.

i. Do you agree or disagree: “The power of education and study can be your salvation in life”? Motivate your answer.

j. Some people believe that university students should be required to attend classes (in some countries it is mandatory for students who want to graduate university). Others believe that going to classes should be optional for students. Which point of view do you agree with? Use specific reasons and details to explain your answer.

86

Unit 13Unit 13Unit 13Unit 13

TTHHEE IINNTTEERRNNEETT –– AA GGRREEAATT IINNVVEENNTTIIOONN OOFF

MMOODDEERRNN TTIIMMEESS

Everywhere you look, you notice something related to the Internet. The Internet is an

impressive creation and the entire world is more and more addicted to it. The Internet is a global system of interconnected computer networks that facilitates

sharing and exchanging information serving billions of users worldwide. And today people can access the Internet almost anywhere

The most traditional communication media: telephone, music, film and television are redefined by the Internet. The Internet has accelerated new forms of human interaction. Online shopping has boomed both major retailer outlets and small artisans and traders.

Educational materials at all levels, from pre-school to post doctoral, are available on websites. In distance education, it helps with homework and other assignments, self-guided learning, etc. It is easier for people to access educational information at any level from anywhere.

Content management systems allow collaborating teams to work on shared sets of documents simultaneously without accidentally destroying each other’s work.

The Internet allows computer users to remotely access other computers and information stores easily, wherever they may be. This is one of the newest ways of working from home, collaboration and information sharing in many industries.

The web has also enabled individuals and organisations to publish ideas and information to a potentially large audience online at great reduced expense and time delay. Publishing a web page, a blog or building a website involves little initial cost and many cost-free services are available.

Advertising on popular web pages is very profitable, while e-commerce or the sale of products and services directly via the web continues to grow.

Electronic mail or email is an important communication service available on the Internet. Internet telephony is another common communication service made possible by the creation of the Internet.

The Internet has enabled new forms of social interaction, activities and organizations thanks to its basic features such as usability and access.

Vocabulary Focus

worldwide – happening or existing all over the world

outlet – a shop or a place where a particular product is sold

boom – a sudden major increase in trade, profits etc. in a particular country or region

artisan – a worker who has special skill and training, especially one who makes things

boom and bust – a situation in which a individual – a person considered separately

87

country’s economy regularly goes through periods of success followed by a period of failure

from their society or community

retailer – a person or a company that sells goods directly to the public for their own use

feature – an important part or aspect of something

Vocabulary Practice

1. Answer the following questions: a. What is the Internet? b. How often do you use the Internet and in what purpose? c. Which are the advantages and the disadvantages in using the Internet? d. How does the Internet help individuals and organizations? e. How important is the Internet for the advertising industry? f. Do you consider that the Internet can help you learn English? Do you take advantage of this?

2. Complete the text with the words or phrases in the list: connected, download, crashes, delete, back up, logged, burn, plugs, virus.

This book takes the reader from the moment he .......... in his computer through to complicated tasks like recovering files. It starts with an introduction to all the basic functions and explains in simple language how to ............your data so it doesn’t get lost if the computer........... or if you accidentally...........an important file. It also has up-to-date information about online services and step-by-step instructions for how to get .............to the Internet and useful sites to visit once you’ve ...........on. In no time at all, you will be able to............ files and install software from the Net. All the key skills that most users need to know such as how to........... a CD and what to do if your PC gets a...........are included. A must-have book for anyone thinking of buying a PC is also required.

3. Match the following terms with their definitions:

a. internet b. e-commerce c. blog d. advertising e. e-mail f. trader g. web page

1. someone who buys or sells things 2. an announcement informing people about a product, service or event 3. buying or selling goods on the Internet 4. page or document that you can read on a web site 5. a system for sending messages from one computer to another 6. a type of diary on a web site that is changed regularly to give the latest news 7. a computer system that allows people in different parts of the world to exchange information

88

4. Fill in: there or it:

a. ..........are a lot of people online and .......overloads the server. b. .........’s so much you can do to improve your memory if you think you are losing........ c. ......’s pointless trying to remind him, he forgets everything. d. .......was such a pity I couldn’t come, but......was nothing I could do about it. e. .......’s time to upgrade our computer.........are some fantastic laptops available now. f. .....’s impossible to know what changes........will be to data storage in the future. g. .......’s probably going to be unsafe. .......are a lot of ways for hackers to get into the system.

GRAMMAR FOCUS MODAL VERBS

Can, could, shall, should, will, would, may, might, must, need, ought to, used to, dare are modal verbs. Modal verbs have more than one meaning in English. They are used to express ability, possibility, probability, logical assumptions, permission, necessity, advice, criticism, obligation, requests, offers, suggestions, prohibition, duty.

Characteristics of modal verbs:

- they do not take -s in the third person singular: He should check the email. - they do not have long infinitive forms: can, could, may, might etc. - they are always followed by a short infinitive: The Internet can offer a huge benefit. - they invert with the subject in the interrogative: May I use your computer? - they can be directly negated by not: You must not forget to confirm it. -they do not have forms for all tenses, but they have equivalents to express them: • can → to be able to • may → to be allowed to / to be permitted to

• must → to have to

Meanings of modal verbs

USE

PRESENT / FUTURE

PAST

Ability John can work on computer. She can make up computer programmes.

John could/was able to work on computer. (past repeated action) He was able to make such a difficult decision.

Possibility He can still be at the office. She could be angry. He might need a new laptop.

He could have had a dispute with the manager. Jane might have broken the keyboard.

Probability He will work tomorrow. They should meet him there. Justin ought to be in London by 10 o’clock in the morning.

They should have finished by now. All the students ought to have started the course.

89

Logical assumption

He must be exhausted. She can’t be serious. They couldn’t be on a trip.

He must have won the competition. They can’t have broken the password. They couldn’t have been there all day long.

Permission Who else can use your password? Guests may not smoke in the conference room. Might I bring a friend with me

He was allowed to attend the business meeting. She was not allowed to take the floor.

Necessity All users must pay for these programmes. He has to find a new address. The computers need to be fed with new data. We ought to reply to his Inquiry

I had to pay for this computer game. She had to find a new address on the Internet. He had to sell his products online. Mary didn’t have to turn off the computer.

Advice You should type faster. They ought to keep to the speed limit. Shall I place the order online?

You should have paid more attention. You ought to have sent the results by e-mail.

Criticism They should warn us. She could at least wait until 4 o’clock.

They should have warned us. She could at least have waited until 4 o’clock.

Obligation I must pay for such information. We ought to give more money to charity.

I had to pay for such information. We ought to have given more money to charity.

Requests Can I use your computer? (informal) Could I use your computer? (polite) May I use your computer please? (formal) Will you give me a hand?

Offers What can I do for you? Shall I help you? Would you like me to do it for you?

Suggestions Shall we stop here? Could we type all the contracts?

The secretary could have sent all the letters.

Prohibition They can’t use the Internet at work. You mustn’t break the rules.

You couldn’t use the Internet at work. Students may not talk during the test.

Duty All users must meet the rules. People must live in harmony.

All users had to meet the rules. She ought to have been more intetested.

GRAMMAR PRACTICE

5. Choose the correct modal + infinitive in each sentence:

a. You should remind him the email because he might / should forget. b. He hasn’t placed the order yet, but he could / can’t do it tomorrow. c. If the manager has another meeting, he should / must call to let me know. d. I think he is not going to dismiss me, so I needn’t / can’t worry. e. The Internet must / can provide us a lot of useful information.

90

f. Shall / would I help you send the mail? g. They could / mustn’t get the information faster thanks to the Internet. h. You could / dare upgrade your computer.

6. Translate into English using modal verbs: a. Vrei, te rog, să închizi calculatorul? b. Nu am putut niciodată să folosesc aceste programe. c. Lucram foarte mult pe calculator când eram în liceu. d. ÎnvăŃământul la distanŃă ar putea fi îmbunătăŃit datorită Internetului. e. Internetul poate fi accesat aproape oriunde. f. PoŃi găsi informaŃii despre orice în câteva secunde. g. Ar trebui să te conectezi la Internet de îndată ce ajungi acolo. h. Dacă te conectezi la Internet, poŃi avea mai mulŃi clienŃi pentru această gamă de produse. i. Nu trebuie să mai verifici adresa de email. Am verificat-o eu deja.

7. Translate into Romanian the following fragment about the birth of YouTube:

In 2005, Chad Hurley and Steve Chen, two software designers from California were invited to a dinner party. Several people had brought theirs camcorders to the party and these people were complaining about how difficult it was to share home videos online. That was when Chad and Steve came up with the idea for YouTube, the site which makes you easy to upload home videos onto the Internet. They formed a company, borrowed some money and set up a business.

It turned out that millions of people already had short home video clips that they thought it might be fun to share with other enthusiasts around the world.

Launched in December 2005, YouTube soon contained more than a million short video clips. People were uploading 8,000 clips a day, and watching three millions a day. They had mostly heard about the site through word by mouth, email and hyperlink, and eighty percent of the clips had been made by amateurs. WRITING FOCUS

8. Write an article about the impact of the Internet on your life. SPEAKING FOCUS

9. Debate on the following topics: a. Do you think that computers are the greatest invention of modern times? b. Do you think that our lives have been improved by the Internet? c. Which is the best way to find out about the news: television, newspapers or the Internet? d. Have you ever chatted on the Internet? Is it dangerous to meet people on the Internet? e. A lot of personal information is now kept on computers. Do you find this worrying? Why? Why not?

91

Unit 14 Unit 14 Unit 14 Unit 14

MMAASSSS MMEEDDIIAA

Since the 1950s, when newspapers, radio and TV began to be the primary sources of

information for a larger and larger percentage of people, these media began to be considered as central instruments of mass communication.

The term “mass media” refers collectively to all information technologies, including the Internet, television, newspapers, film and radio, which are used to transmit news to a large number of people.

In this era of globalization, people depend on information and communication to remain connected with the world. Consequently, it is imperative to explain the three basic functions of mass media; they provide news/information, entertainment and education. The first and foremost function of the media in a society is to provide news and information to the masses; that is why the present era is also named the information age. People need news/information for various reasons, to socialize or to make decisions and formulate opinions. Entertainment would be the other function of the mass media where it is mostly used for amusement and relaxation. Educating the masses about their rights, moral, social and religious obligations is another important function of mass media.

The way we dress, what we eat and how we live our lives is influenced by the media. The media make billions of dollars with the advertising they sell and that we are exposed to every single moment. We buy what we are told to buy. We construct our lives based on the trends that the media imposes on us. The media has a significant influence upon our lives.

Of all the media distribution channels the most influential has been the television. We are constantly exposed to thousands of news, commercials, documentaries, movies, talk shows, music and educational programmes. Television viewing is a major activity and it occupies a large portion of people’s time.

To understand how important television is, we can look at the variety of programmes and the valuable content it offers and the purposes it serves in daily life. The viewer can watch a weather report to prepare for the day. Cartoons and sport provide relaxation and fun. School programs, documentaries and the news teach us about the world, while advertisements inform us about products and new ideas. TV not only provides many types of programmes with interesting content, but it also offers entertainment and knowledge. It can contribute positively to the education of society and people’s awareness of others, and it will continue to have a strong influence.

The radio plays an important role in sharing information. It has something for everyone: music for the ones who just want to relax and listen to famous bands, radio shows and news for those who want to be informed. The radio represented the beginning of a network of worldwide communication; it was one of the greatest inventions in the 20th century and it is still needed and used by millions of people today.

The press is another powerful medium. It has the ability to influence the way people view the world, as well as their opinion of what they see. A free and independent press is very important in today’s society as it represents one of the instruments used by the state in order to maintain the status quo.

92

The press consists of newspapers and magazines. Newspapers provide various information on politics, finance and economics, on arts and theatre, on science and culture; they present TV programmes, information about the weather etc. Newspapers fall into two categories: the popular papers (tabloids) interested in scandals and stories about the life of celebrities, and the quality papers (broadsheets) presenting economic news, politics, sport, business, entertainment, etc.

People usually buy their papers from a newsagent, but others prefer to receive it at home, that's why they subscribe to their favourite paper. The front page is covered with big headlines while the cover of a magazine is often a colour photograph.

A magazine is a publication with a variety of articles divided into several sections: politics, sports, business, home decorating and gardening etc. It includes various things such as: world news to know what's going on in the world, articles and stories about famous people, fashion styles, ads for various products or services, wanted ads for people who are looking for a job or people who want to buy/sell things, film or book reviews to know about the latest movie to see or the latest book to read, the readers' mail or letters to the editor, comics for children or adults, the horoscope for superstitious people, the agony column or the lonely heart column for people who have problems in their sentimental lives, crosswords and games to pass the time when travelling on buses or trains, surveys and opinion polls to discover what the majority of people think, many photos and articles to report on events etc. Vocabulary Focus

mass – a quantity of matter usually of considerable size

to shape – to form, to create, to give a particular form or shape to

billion – a very large number: one thousand million

awareness – having or showing realization, perception, or knowledge

status quo – the existing state of affairs, normality

worldwide – extending throughout the entire world, global

content – something that is contained to impose – to establish or apply by authority trend – a line of general direction or movement, tendency

poll – the casting or recording of the votes of a body of persons

Vocabulary Practice

1. Answer the questions: 1. What does the term “mass media” refer to? 2. Which are the three basic functions of mass media? 3. What is the information age? 4. How does mass media influence society? Give some examples of positive and

negative influences of mass media. 5. Enumerate some TV programmes that you usually watch. 6. What is the importance of the radio today? 7. Are you a great reader of newspapers? 8. Name some famous newspapers/magazines. What type of information do they provide?

93

2. Match the terms to their definitions:

1. editorial a. any information on current events which is presented by print, TV broadcast or Internet to a mass audience

2. magazine b. photographers who follow celebrities in order to photograph them for publication

3. headline c. a term used to describe sensational news reporting 4. news d. a Web site, usually maintained by an individual with regular

entries of commentary, descriptions of events, or other material such as graphics or video

5. advertising e. news which is just coming in 6. blog f. the text at the top of a newspaper article, indicating the nature of

the respective article 7. yellow journalism

g. a form of communication that typically attempts to persuade potential customers to purchase or to consume more of a particular brand of product or service

8. tabloids h. a publication containing a variety of articles on finance, economy, politics, sports etc, published weekly or monthly

9. breaking news

i. an article in a newspaper or magazine that expresses the opinion of the editor, editorial board, or publisher

10. paparazzi j. newspapers of small format reporting gossip or stories with illustrations about famous people

3. Choose the right word and fill in the blanks: published, pick up, change, broadcasts, shot, edited, shows, censored

a. The BBC World Service … news throughout the world. b. This TV channel … a good film every night at 9:30. c. The book was … by ABC Press and it was sold on the Japanese market. d. The film that got the Oscar last year was … in Spain. e. Do the antennas in the neighbourhood … all TV stations? f. They … the film before showing it on TV. g. The main article in this business magazine has been badly … . h. You can … the TV channels only if you use the remote control.

4. Find definitions to explain the jobs of the following people involved in the media: Example: A make-up artist makes up the faces of people who are to appear on TV.

1. a foreign correspondent 2. an editor 3. a publisher 4. a camera operator

5. a reporter 6. a newsagent 7. a film director 8. a journalist

94

5. Make up sentences with the following words and expressions: to spread news, weekly paper, foreign news, press agency, TV channel, on the air, broadsheet, press release, crosswords, to subscribe. GRAMMAR FOCUS DIRECT AND INDIRECT SPEECH

Direct Speech / Quoted Speech

Uses: Examples:

1. It is used to repeat or quote the exact words used by another speaker

“I go to the university every day”, Jim said. She said to me, “Stop talking so much!” The student said, “I'm going to pass this exam.”

Note: In direct speech, we use quotation marks to enclose the words spoken without making any other changes in the sentence. Examples: She asked: “Will you read this article?”

He said “I want a newspaper”.

Indirect Speech / Reported Speech

Uses: Examples:

1. It refers to repeating what another person says. When we report what someone says, we do not repeat exactly every word that was said

“I am reading a tabloid now.” → She said that she was reading the tabloids then. “Don’t sell the magazine at this price!” → He advises me not to sell the magazine at that price.

2. When reporting a command, wish or suggestion, say or tell is followed by a that-clause or a shortened infinitive clause

The doctor said, "Get some rest." → The doctor said that I should get some rest./The doctor told me to get some rest.

3. When reporting questions, the sentence order is very important. When reporting yes/ no questions connect the reported question using 'if'. When reporting questions using question words (why, where, when, etc.) use the question word. The verb to say is replaced with to ask, to inquire, to wonder etc.

Ann said "Do you want to come with me?" → Ann asked me if I wanted to come with her. Dave said, "Where did you go last weekend?" → Dave inquired where I had gone the previous weekend. He asked, "Why are you studying English?" → She wondered why I was studying English.

Note: When changing from direct speech to indirect speech, it is often necessary to change the pronouns to match the subject of the sentence. It is also important to change time words when referring to present, past or future time to match the moment of speaking. Examples: “I speak English.” → He says that he speaks English. “Carol, open the door!” → He told her to open the door. “I am living in London now.” → She said she was living in London at that moment. “They bought a new car last year.” → They said that they had bought a new car the previous year. “I haven’t seen Julie”. → She said she hadn’t seen Julie. “I’ll see you later.” → She said she would see me later.

95

GRAMMAR PRACTICE 6. Fill in the sentences with the right form of the verbs to say or to tell:

1. Ann …. goodbye to me and left. 2. …. us about your holiday. Did you have a nice time? 3. Don't just stand there! …. something! 4. I wonder where Sue is. She …. she would be here at 8 o'clock. 5. Jack …. me that he was fed up with his job. 6. The doctor …. that I should rest for at least a week. 7. Don't …. anybody what I …. . It's a secret just between us. 8. “Did she …. you what happened?” “No, she didn't …. anything to me.” 9. George couldn't help me. He …. me to ask Kate. 10. They never … me the truth.

7. Transform the sentences into reported speech. Make the necessary changes: 1. Karen: "Don't buy too many newspapers!" → Karen warned me … 2. Victoria: "Check your e-mails now!" → Victoria told me … 3. Teacher: "Don't forget to do your homework!" → The teacher reminded me … 4. Mike: "Don't shout at Peter!" → Mike told me … 5. Fred: "Come with me to the cinema today!" → Fred told me … 6. Yvonne: "Don't talk so loud!" → Yvonne told me … 7. Jessica: "Write an article for this magazine!" → Jessica told me … 8. Denise: "Don't open the door!" → Denise told me … 9. Student: "Meet me at 5 p.m.!" → The student told his colleague … 10. Jane: "Don't let the kids watch that scary movie!" → Jane advised me …

8. Complete the sentences in reported speech. Change the pronouns and the verbal forms: Helen is in front of the class holding a presentation on London. As Helen is rather shy,

she speaks with a very low voice. Your classmate Gareth does not understand her, so you have to repeat every sentence to him.

Helen: I want to tell you something about my holiday in London. Gareth: What does she say? You: She says that … Helen: I went to London in July. Gareth: What does she say? You: She says that … Helen: My parents went with me. Gareth: What does she say? You: She says that … Helen: We spent three days in London. Gareth: What does she say? You: She says that … Helen: London is a multicultural place.

96

Gareth: What does she say? You: She says that … Helen: I saw people of all colours. Gareth: What does she say? You: She says that … Helen: Me and my parents visited the Tower. Gareth: What does she say? You: She says that … Helen: One evening we went to see a musical. Gareth: What does she say? You: She says that … Helen: I really love London. Gareth: What does she say? You: She says that …

9. Complete the sentences in reported speech. Note whether the sentence is a request, a statement or a question and whether you have to change the tenses or not:

1. "I was very tired," she said. → She said … 2. "Be careful, Ben," she said. → She told Ben … 3. "I will get myself a drink," she says. → She says … 4. "Why haven't you phoned me?" he asked me. → He wondered … 5. "I cannot drive them home," he said. → He said … 6. "Peter, do you prefer tea or coffee?" she says. → She asks Peter … 7. "Where did you spend your holidays last year?" she asked me. → She asked me … 8. He said, "Don't go too far." → He advised her … 9. "Have you been shopping?" he asked us. → He wanted to know … 10. "Don't make so much noise," he says. → He asks us …

10. Translate the sentences into English and then transform them into reported speech: a. I-am spus Mariei: “Îi cunoaştem de zece ani, sunt cei mai buni ziarişti de la Sunday Times”. b. Redactorul-şef mi-a spus: “Lucrez la această editură de 4 ani”. c. Ghidul le-a spus turiştilor: “Vă voi da toate informaŃiile necesare despre noua destinaŃie mâine”. d. M-a întrebat: “ÎŃi place să citeşti reviste”? e. I-am răspuns: “Da, îmi place foarte mult. Am citit deja două astăzi”. f. L-am întrebat: “Ce ai de gând să scrii acum?” g. M-a întrebat: “De când înveŃi engleza?” h. Am întrebat-o: “Le-ai spus totul despre noul articol?” i. L-am sfătuit: “Cumpără un ziar de la chioşc ca să afli ce s-a întâmplat!“ j. I-am întrebat pe jurnaliştii de la Adevărul: “Când aŃi publicat acest articol?” k. I-am spus Mariei: “Mergi la redacŃie!” l. Le-am spus: “CitiŃi The Observer şi spuneŃi-mi ce scrie în editorial”. WRITING FOCUS

10. a. Write an article for the university newspaper in which you present your point of view regarding student life. b. Find an article in a newspaper or magazine and translate it into English.

97

SPEAKING FOCUS

11. Debate on the following topics: a. How often do you read the paper or watch the news on TV? b. How important is it for you to keep up with current events? c. Do you think that most newspapers print what's really important, or what will make them sell more newspapers? What about TV news? d. Do you believe that mass media provides a clear image of the realities around us? e. Do you think that news reporting has got better, worse, or stayed the same over your lifetime? f. How do you feel about censorship? Are there times when the news should be censored? g. Do you think that the media is objective? Why or why not? h. Do you think that the media covers too much bad news and not enough good news? What was the last "good news" story you heard? i. Is the role of mass media to inform or to control people? State your opinion on: “Whoever controls the media, controls the mind”.

98

Unit 15Unit 15Unit 15Unit 15

OONNLLIINNEE SSHHOOPPPPIINNGG

These days lots of people shop online. This is the process whereby consumers

directly buy goods or services from a seller in a real time, without an intermediary service, over the Internet.

In recent years, online shopping has become popular; however, it still caters to the middle and upper class. In order to shop online, one must have access to a computer as well as a credit card or a debit card. Online stores are usually available 24 hours a day and many consumers have Internet access both at work or at home. Other establishments such as Internet cafés and schools provide Internet access as well.

Most people shop online for the convenience provided, but also to pay the lowest possible price. They visit different websites to shop around for the lowest price, but today an automatic shopping comparison is possible thanks to a browser automatically showing the prices for the same item at different online stores on the web. In this way, customers can easily compare prices and choose which one to buy.

E-commerce has a huge impact on the way we are doing a business. It helps us increase the number of customers on the market, improve efficiency and effectiveness and transform all business processes. It’s cheaper for a retailer to set up a website than it is to rent a shop, fit it out and pay someone to work there. Besides, a website has global reach, so customers can come from all over the world.

However, there are also some disadvantages of shopping online. Your credit card can be put at risk. You must ensure that you only use safe sites and be very careful with your credit card details or someone else may be able to use your credit card. On the other hand, the picture you have on your computer screen might not reveal the true quality and the product might not meet your expectations. As you cannot touch or examine things before you buy them, you may be disappointed when your purchase arrives.

All in all, there are both advantages and disadvantages to shopping online. It is easy and convenient, but it is also risky and dangerous. Vocabulary Focus

to cater – to provide food or drinks at an event

to cater to – to provide people with everything they want or need

item – an individual thing, usually one of the several things in a group or on a list; an article in a newspaper or magazine

browser – a computer programme that allows you to look at and search through information on the Internet; someone who is looking at things in a shop without being sure whether they want to buy anything

establishment – any institution, retailer – a person or a company that sells

99

organization or business goods directly to the public for their own use

convenience – a condition that makes it easier to do something and helps you to avoid wasting time or effort

to fit out – to put equipment into a room or building so that it can be used for a particular purpose

Vocabulary Practice

1. In most lines of this text, there is one extra word. Write the extra word or put a tick if the line is correct:

First came the PC, then the Internet and email; now the e-book is upon us, a hand-held device similar in size and appearance to a video cassette. The user simply calls up the website on their PC, selects the desired book, downloads it onto their e-book machine and sits down to read it. For to turn a page, the user simply taps the screen. E-book technology is being evolving rapidly. But why would one want an e-book machine if in preference to a book? Well, one selling-point companies emphasised, when these devices had hit the market, is the space they did save when going on holiday. E-books lighten the load, literally. Ten large novels can be put onto a device that is weights less than the average paperback. One can understand why commercial interests seem to be want us to change.

2. Use the word given in brackets to form a word that fits the space: There are more and more magazines with an ever larger proportion of ads, where

clearly a fortune has been spent on the................... (produce) of the ad. This may be because the advertisers have paid to use a famous celebrity or because of using an exotic ................ (locate) as background or because the ad uses expensive photography and ............... (graph). People become ................. (increase) sophisticated so ads should also become more .................. (challenge) to catch our attention. At the same time, as more and more people are hooked into an ever-expanding range of TV channels, advertising on television becomes .................. (price). Because of this, some experts say the TV companies may lose their market as the Internet competes for our attention. It is becoming .................... (economic) now for companies to use TV as they don’t get the returns they demand on their ................. (invest). But advertising on the Internet has opened up a whole new ball game of .................... (possible). In fact, consumers are getting very .............. (resent) as the mainly pop-up ads used on the Internet are seen as a gross ................ (intrude) of privacy by most of us. GRAMMAR FOCUS

THE CONDITIONAL MOOD

The Conditional Mood has two tenses: present and past.

1. Present Conditional (+) S+ should / would + V1 (-) S + should not / would not + V1 (shouldn’t’ t / wouldn’t) (?) Should / Would + S + V1?

100

2. Past Conditional (+) S + should / would have + V3 / V-ed (-) S + should not / would not + have + V3 / V-ed (shouldn’t’ t / wouldn’t) (?) Should / Would + S + have + V3 / V-ed?

Both Present and Past Conditional have a continuous aspect expressing actions or states in progress. Examples: Justin would be working if he were not so tired. Justin would have been working if he had not been so tired.

CONDITIONALS

First Conditional (probable condition) Main Clause if Conditional Clause Present / Future Present Tense V1/ shall / will + V1 if V1 Example: I place the order online if I know the delivery terms.

I shall place the order online if I know the delivery terms.

Second Conditional (hypothetical / improbable / rejected / unreal condition) Present Conditional Past Tense Subjunctive Should / would +V1 if V2 / V-ed (* to be – were) Example: I should place the order online if I knew the delivery terms.

Third Conditional (impossible condition) Past Conditional Past Perfect Subjunctive should / would +have + V3 / V-ed if had + V3 Example: I should have placed the order online if I had known the delivery terms.

Notes: 1. Alternatives to if

There are some other alternatives to if: unless, on condition (that), provided / providing (that), as long as, in case, suppose / supposing (that), whether. Examples: You will pay extra charge unless you shop online.

I shall buy the books on condition that I have enough money on me. You can shop online as long as you have a credit card. Please contact me in case your computer is broken. Supposing you had access to this address, what would you be interested in? We shall attend this training course whether the company pays for us or not.

2. The omission of if When if is omitted for stylistic purposes, an inversion take place.

Example: Were the electricity supply to fail, the machines would automatically switch off. Had we placed the order earlier, we would have received it until now.

3. Mixed Conditionals We can make up mixed conditionals if the context allows it, by combining an if-clause from

one type with a main clause from another. Example: If you were more careful, you wouldn’t have broken the keyboard. (2+3)

If he hadn’t missed the bus, he would be at work now. (3+2) GRAMMAR PRACTICE

101

3. Use the verbs in brackets in the correct form: a. You would get a better price for your products if you (to launch) them this year. b. If he (to be ready), he might come with us. c. They would have hired me if I (to prove) computer skills. d. I couldn’t have sent you the offer if you (to have) an available email. e. If we (to shop) online, we could pay the lowest price for this item. f. You would have saved time and money if you (to use) the Internet. g. In case the online store (to be) still available, would you have placed the order?

4. Complete the following conditional sentences: a. The manager wouldn’t have signed the contract if …. b. Had I had a laptop …. c. If they found all the necessary information, …. d. What would you buy if ….? e. If I were you,…. f. If she finds new online stores, …. g. If I had known about the contract,….

5. Choose the best ending for each sentence:

1. If I were rich, …. 2. If you didn’t smoke, …. 3. If you read the instructions, …. 4. If I were you, …. 5. If the computer is out of order, …. 6. If they worked harder, …. 7. If you lend me some money, …. 8. If we don’t hurry, ….

a. …. I will pay you back tomorrow. b. …. they could finish in due time. c. …. I would buy an expensive car. d. …. try to have it fixed. e. …. we’ll be late for the meeting. f. …. I wouldn’t do that. g. …. you’d feel better. h. …. you would know what to do.

6. Choose the correct answer for each gap. 1. Supposing you ............a large sum of money, what would you do with it?

a. win b. will win c. won 2. If you..........to me, you wouldn’t be in this situation now.

a. listen b. will listen c. had listened 3. Unless you.........him, he will not help you.

a. will ask b. ask c. asked 4. Provided you leave now, you...........get there on time.

a. will be able to b. were able to c. would have been able to. 5. If he..........the answer, he would tell you.

a. knows b. would know c. knew 6. I should have lent you that book provided you....... it by the end of the week.

a. would have returned b. had returned c. returned 7. If you..........the phone number, I would have called you.

a. gave b. would have given c. had given 8. If they...........time, they would have delivered the merchandise on time.

a. would have had b. will have c. had had

102

9. Don’t come unless he............you. a. tells b. doesn’t tell c. will not tell

10. If he..........harder, he might become a good sales manager. a. has worked b. worked c. would work

7. Translate into English: a. Aş fi cumpărat online dacă aş fi ştiut că preŃurile sunt mai mici. b. Ce decizie ai lua dacă ai fi in locul meu? c. PoŃi să cumperi online dacă ai un card de credit. d. Dacă doriŃi să primiŃi produsele până săptămâna viitoare, trebuie să plasaŃi deja comanda. e. Dacă aş fi în locul tău, nu aş cumpăra nişte produse atât de scumpe. f. Am putea să vă acordăm o reducere pentru comenzi mai mari. g. Dacă doriŃi să primiŃi detalii în legătură cu această reducere, vă vom trimite oferta noastră săptămâna viitoare. h. Dacă preŃurile sunt acceptabile, vom plasa o comandă de probă. i. Dacă mărfurile nu ar fi fost în stoc, nu ar fi fost livrate atât de repede. 8. Translate the following fragment on “putting the fun into shopping”:

These days, throughout the length and breath of Britain shopping centres do not only provide customers with a formidable array of products to choose from, but they also employ a range of subtle entertainment techniques to make you want to buy them. Sometimes, it is a simple idea such as a bookshop providing a café where customers can sit and read in comfort, or a fashion show put by a department store. Sometimes, the concept is more hi-tech, like the electronic games and huge video screens showing cartoons in a children’s toy shop. Whatever the method, retailers realise that offering some kind of pleasant experience is good for business, particularly nowadays with so many people buying their goods online. WRITING FOCUS

9. Write a short article expressing your opinion about online shopping. SPEAKING FOCUS 10. Answer the following questions:

a. Which are your favourite online shops? Why? Tell your partner. b. Are you pro or against online shopping? Debate upon its advantages and

disadvantages and then choose a side, explaining your choice. c. What can you do to protect yourself against the risks of shopping online?

103

Unit 16Unit 16Unit 16Unit 16

EENNTTEERRTTAAIINNMMEENNTT

Everybody loves leisure time; everybody wishes to have more spare time; everybody

goes to work and can’t wait for the weekend or vacation to come. Why? Well, simply because this free time represents the time they decide how to spend, it is the time they dedicate to their families, friends or to their own.

Nowadays all the types of different activities that people use to amuse themselves can be generally called entertainment. People throughout the world have various ways of relaxing and entertaining themselves, many differing according to age, interests, season, society, culture, traditions or customs. Generally speaking, entertainment represents the types of activities that provide amusement for people either in an active way (involving participation) or in a passive way. There is a wide range of choices when it comes to selecting your favourite type of entertainment, either for groups or individuals, for outdoor or indoor activities, local, national or international ones.

These days there is a whole industry that deals with entertainment and if you have what it takes you can start up a business by opening your own entertainment agency which can be very successful as long as you find a market for your products and services.

Children mostly prefer active recreation that provides a balance between mental and physical activities according to their age: games, sports, music and dance, cartoons, puppets, clowns, pantomimes, storytelling, comics and so on. Children also love organized parties provided by entertainment agencies which bring magicians, singers, actors or famous look-alikes to make their parties unforgettable.

Teenagers and young people mostly prefer active entertainment, usually in groups; the most modern is going to clubs, discos, watching movies at malls or shopping centres, going to live concerts, practicing sports, etc.

Adults can prefer both active and passive leisure activities, mostly live entertainment for all ages and which includes music concerts, live TV shows, live sports, theatre performances or plays, opera, reading clubs, social dance (dance courses), comedy, stand-up comedy, etc. Families usually prefer travelling or playing games as a way of relaxing themselves, such as chess, card games, Monopoly, ball games, etc. Such indoor or outdoor activities allow members of a family (friends or relatives) to spend time together, to develop physical or mental abilities and release work pressure.

Nowadays there is a wide range of public entertainers that offer the public what it wants in exchange for an amount of money, usually known as corporate entertainment it is provided by an entertainment agency whose main aim is to organize parties, theme parties, outdoor parties or events, to hire mimes or bands that play all types of music. Such activities can also be a good source of attracting tourists to a special location. In the US, for example, there are also some non-conventional relaxing activities, such as bird-watching or tree-hugging.

You can see how all these different types of entrainment can lead to a successful business, how they can broaden people’s tastes and influence them by offering more and

104

more choices and recreate people, helping them recharge their batteries. Nevertheless, a major criticism of entertainment is that it diverts people’s time and money away from activities that are considered meaningful, such as volunteering or studying. This type of criticism is based on indoor activities, such as watching TV or movies, playing computer games or surfing the Internet – activities which turn people into “couch potatoes” or distance them from real friends and real socializing.

However, people become more and more aware of such risks and they have the possibility to choose their favourite and most suitable form of entertainment. Vocabulary Focus

leisure/spare/free time – time available for ease and relaxation

look-alike – one that closely resembles another; a double

entertainment – the act of entertaining; something that amuses, pleases, or diverts, especially a performance or show

outdoor – located in, done in, or suited to the open air; taking place, existing, or intended for use in the open air

to start up – to come or cause to come into being for the first time; originate

pantomime – communication by means of gesture and facial expression; a player in such a pantomime performance

to have (got) what it takes – to have the skills, power, intelligence, etc., to do something

couch potato – a person who spends much time sitting or lying down, usually watching TV

puppet – a small figure of a person or animal, designed to be fitted over and manipulated by the hand; a marionette; a doll

recharge one’s batteries – take a break from activities which are tiring or difficult in order to relax and feel better when you return to these activities

Vocabulary Practice

1. Answer the following questions about the text: a. Why do people love entertainment and leisure time? b. What do you understand by entertainment? c. Which are the most common types of entertainment? d. Talk about the types of entertainment that you know based on age, interests, society

and culture. Give some clear examples. e. What does it take to run a successful entertainment agency? f. What types of services does an entertainment agency offer? g. What is the major criticism brought to entertainment nowadays?

2. Match the following words to form series of two or three synonyms: leisure expand custom show outdoor free dynamic adult entertain advantage active spare tradition amuse outside mature broaden performance benefit

105

3. Find the word family of the term entertainment. 4. Read the following email and identify the expressions that make it informal; then

rewrite it by replacing the informal structures with some of the semi-formal or formal ones from the box below the email.

Hi Jack, What's up? Glad to hear from u. Well, thanks for ur last email. Sorry I didn't have time to write u back but I was very busy at work. I wanna tell u I'm gonna plan a party weekend out in the open and I wanna invite all my pals at my crib to have a blast next weekend. By the way, this is ur invite. U r the 1st on my list. Please come! We're gonna swim in the pool, play some football, shoot some pool or darts, later on grab something to eat and have a sip, listen to some nice music and cut the rug a little. How about it? Hope to see u soon. Cheers, mate! Dani

you want to house your friends outdoor How are you? drink billiards going to have a lot of fun thank you invitation I am play write soon dance

GRAMMAR FOCUS

FORMAL AND INFORMAL SPEECH

In English, as in any language, there is a difference between formal and informal speech, which is not a problem of correct or incorrect language, but one of register – which is a variety of language, related to a particular subject matter or area of activity, a set of words and expressions as well as syntactical features that they may be suited to characterize that specific area of language.

Formal (academic) writing and speaking is quite different from informal written and spoken English and the differences are obvious in colloquialisms (conventional expressions) that are inappropriate for formal written English.

Formal English is specific to written contexts (such as business or official correspondence, reports, etc.). Informal English is generally used with family and friends; it is mostly used in spoken language, but also in written informal letters, e-mails, on socializing networks, etc.

For English language speakers it is very important to be aware of such differences in spoken and written English, in both grammar and vocabulary, and not to mix the two registers.

106

Examples Formal register Informal register

Contracted forms

They have played tennis many years. I am outside.

They’ve played tennis many years. I’m outside.

Relative structures

The boy believed that he was on time. The woman who you are talking about is my sister.

The boy believed he was on time. The woman you are talking about is my sister.

Use of “whom”

Whom have they mentioned? Who have they mentioned?

Auxiliary verb usage

Have you ever been there? Ever been there?

Word choice (phrasal verbs)

The police investigated the situation. Unfortunately, his aunt died last year. I learned some Italian while I was in Rome.

The police looked into the situation. Unfortunately, his aunt passed away / passed on last year. I picked up some Italian while I was in Rome.

Prepositions To which nation does he belong? Neither of them uses this service.

Which nation does he belong to? Neither of them use this service.

Vocabulary They repaired the sink. Thank you for your attention. I beg your pardon?

They fixed the sink. Thanks for your attention. Sorry? / What? / Pardon?

Passive v Active voice structures

Passive voice structures The participants were given a diploma.

Active voice structures They gave the participants a diploma. / The participants received a diploma.

GRAMMAR PRACTICE

5. Which are the main differences between a formal and an informal letter? Use the following expressions to help you decide and match them to the informal and formal register: Dear Tom, Dear Mr Jones, I am sorry to inform you that … Best wishes, I’m really sorry … Yours faithfully, Thanks for your letter Love, I look forward to hearing from you

Write soon I’m happy to hear that … Our products are used for a variety of … Did you know that …? Dear Sir or Madam, If you’ve got any questions, … In accordance with … In response to your previous …

Formal letter: …………….. Informal letter: ……………….. 6. Match up the formal sentences below to their informal equivalents:

a. I’m sorry but … b. The company laid him off because he didn’t work much. c. Should you require any assistance, please fell free to contact us …

107

d. His insufficient production conducted to his dismissal. e. We have the pleasure in announcing that … f. We’re going to have a blast tonight. g. We regret to inform you that … h. I’m happy to say … i. We will enjoy some quality time this evening. j. If you need any help give us a call.

7. Match the following underlined phrasal verbs to their more formal explanations on the left:

a. People work out at the gym as often as possible in their leisure time to burn off the calories and keep fit.

b. It is highly important to begin your set of exercises with a warm up and in the end it is vital to cool down and stretch properly.

c. If you want to win a game or a competition you must never give in. d. Table tennis is a great sport; anyone can join in. e. He will be sent off the pitch if he continues this aggressive behaviour. f. I’m sure out football team will go out to Argentina in the semi-finals. g. Our team won the game and so they went forward to the next

round.

1. participate 2. progressed 3. surrender 4. exercise 5. told to leave 6. become cooler 7. be defeated by 8. get rid of 9. gentle

exercises 8. Translate the following letter into Romanian and decide whether it is formal or

informal. Then rephrase it into the opposite register using some of the expressions in the box below the text to help you:

Joanne McQueen 5 Hill Street Madison, Wisconsin 53700

April 15th, 2011

Ms. Helen Jones Chief Editor Daily News Boston, Massachusetts 01234

Dear Ms. Jones,

I am writing to announce you that I received you letter from March 5th in which you requested details on my sister’s leisure activities in view of publishing an article in your local newspaper. Florence McQueen, as a professional swimmer, does not have much leisure time, but when she does, she likes to relax. She spends a lot of time with friends she was in school with. They like shopping or simply making conversation at one of their homes. Sometimes they go in the countryside to spend some time outdoors,

108

to play different games or to paint since she has a secret passion for art in general and for painting in particular. I hope the information I provided you with meets your expectations and if you need further details please contact my sister for an interview or telephone conversation – if necessary I will offer you her contacts.

Yours sincerely, JMcQueen

Joanne McQueen

chitchat hang out get in touch with/drop a line to pal/mate let someone know get ask for love give live up to loosen up craze get more time off

WRITING FOCUS

9. a. Write an informal letter to a pen friend describing your favourite leisure activity. b. Write a formal letter to an entertainment agency asking for further information on their

services and agenda. SPEAKING FOCUS

10. Discuss and express your opinion on the following topics: a. Do you agree that entertainment can also have negative effects on people? If yes, explain why. b. Which are the benefits of entertainment on people? c. Which is your favourite type of entertainment? Why? d. What are, in your opinion, the typical Romanian leisure activities?

109

Unit 17Unit 17Unit 17Unit 17

CCUULLTTUURRAALL DDIIFFFFEERREENNCCEESS

Travelling to all corners of the world gets easier and easier. We meet people of

different nationalities, but how well do we know and understand each other? There are many differences between people within any nation or culture. Education, social standing, religion, personality, beliefs, past experience, family care, and many other factors affect human behaviour and culture. It is true that there are cultural and ideological differences and it is good to have an understanding about a culture's customs and ways.

Imagine you have arranged a meeting at four o’clock. What time should you expect your foreign business colleagues arrive? If they are German, they will get in time. If they are Americans, they will probably be 15 minutes early. If they are British, they’ll be 15 minutes late, and you should allow up to an hour for the Italians. There is an international etiquette concerning how to behave with foreign business partners. If you want not to behave badly abroad, you should know something about the customs of your business partner’s country:

• The British are happy to have a business lunch and discuss business matters with a drink during the meal, while the Japanese prefer not to work while eating. Lunch is a time to relax and get to know one another, and they rarely drink al lunchtime.

• The Germans like to talk business before dinner, while the French like to eat first and talk afterwards. They have to be well fed and watered before they discuss anything.

• American executives sometimes show their feelings of ease and importance in their offices by putting their feet on the desk. In Japan, people would be shocked because showing the soles of your feet is the height of bad manners.

• The Japanese have perhaps the strictest rules of social and business behaviour. Seniority is very important, and a younger man should never be sent to complete a business deal with an older Japanese man. The bow is a very important part of greeting someone. You should not expect the Japanese to shake hands. Bowing the head is a mark of respect and the first bow of the day should be lower than when you meet thereafter.

• The Americans sometimes find it difficult to accept the more formal Japanese manners. They prefer to be casual and more informal, as illustrated by the well-known “Have a nice day!”. American waiters have a one-word imperative: “Enjoy!” The British, of course, are cool and reserved. The frequent topic of conversation between strangers in Britain is the weather. In America, the main topic between strangers is the search to find a geographical link. “Oh, you live in Ohio? I have a friend who once worked there.”

We notice that good manners are dependent on culture; an excellent etiquette in one society may shock another. Most of the problems between nations grow from deep misunderstandings between people, and many of those misunderstandings are rooted in cultural differences. That’s way people should know more about other countries, about different customs, traditions and cultures.

110

Vocabulary Focus

belief – a feeling that something is good, right, or valuable

to allow – to permit, to regard or treat as acceptable

to behave – to act in a particular way ease – a relaxed and informal way of behaving

etiquette – the rules indicating the proper and polite way to behave

bow – the act of bending forward at the neck or waist in order to greet someone or show respect

formal – showing great concern for behaving in a proper and serious way

informal – not formal, having a friendly and relaxed quality

Vocabulary Practice

1. Answer the following questions: a. Which nationalities are the most and least punctual? b. Why do the British consider that everyone understands their customs? c. Which nationalities do not like to eat and do business at the same time? d. Which nationalities have rules of behavior about hands? What are the rules? f. What differences of manners are there between Americans and British?

2. Fill in the blanks with the following words: opposite, due to, American English, left, throughout, culture, right, mixture

There are vast differences in ...........between Americans and their British Commonwealth counterparts throughout the world. .........................is spoken in the USA, Canada and many Pacific Rim countries where America has had some influence. British English is spoken.................. the British Commonwealth of 54 countries, some of the most notable being the United Kingdom, Australia, New Zealand and South Africa, Canada being the exception. Although part of the Commonwealth, Canadians tend to speak a ……….. of American and British English............... that country's proximity to the USA (although they spell the British way). In what driving is regarded, the first thing to be considered is that fact that Americans drive on the ............... and in the Commonwealth you drive on the .................. Now if that isn't confusing enough, even the road markings are opposite. In America yellow lines signify the center of the road and white lines represent the edge while exactly the ..............occurs in most Commonwealth countries.

3. Circle the correct answer: 1) In the U.S., Canada and most European countries, you are expected to arrive ................

for appointments or meetings. a. late b. on time c. not on time

2) In Spain, you're expected to arrive .................. for most appointments or meetings a. late b. early c. on time

3) In Japan, China, Korea and Vietnam, never pass something to an older person or superior with only one hand; you're expected to use ............... a. right hand b. left hand c. both hands

111

4) In the U.S. and Canada, don't .................. if you're invited to someone's home. a. call b. arrive early c. go

5) In the U.S. and Canada, you're supposed to ......…...... if you plan to visit someone at home. a. go first without calling b. arrive early c. call first

6) In many Asian countries, it is .............. to visit your friends at home without invitation or prior appointment. a. acceptable b. not acceptable c. unusual

7) In most countries, when you meet someone for the first time, you aren't ............. to hug or kiss them. a. should b. must c. supposed

8) In Peru, Columbia, Brazil, Bolivia and Mexico, it is common to ................. someone you have just met for the first time. a. kiss b. bow at c. ignore

9) In the U.S., Canada and many European countries, it is ................. to eat noisily in front of others. a. polite b. impolite c. OK

GRAMMAR FOCUS

BRITISH ENGLISH – AMERICAN ENGLISH

There are many differences between British and American English. Generally, it doesn't matter which variety of English you speak or write, but in a text you must use either British or American spelling. Here are some of the biggest differences between British and American English.

BRITISH ENGLISH AMERICAN ENGLISH

Vocabulary

flat pavement curtains lift lorry rubbish holiday return ticket zebra crossing roundabout bookshop term

apartement sidewalk drapes elevator truck garbage/trash vacation round trip pedestrian crossing traffic circle bookstore semester

Grammar 1. British speakers use "yet" with the present perfect tense, while American speakers tend to use the Past Simple. 2. British speakers use “at the weekend”, while American speakers say “on the weekend”.

1. Have you eaten dinner yet? Did you eat dinner yet?

112

2. at the weekend on the weekend

Punctuation In British English, the final comma before "and" (in a list) is omitted, but not in American English.

She bought cereal, coffee, sugar and tea. She bought cereal, coffee, sugar, and tea.

1. –our and –or: British English tends to use -our ,whereas American English uses -or:

colour neighbour favour

color neighbor favor

2. –re and –er: Some noun endings are -re in British English, but -er in American English:

theatre centre

theater center

3. – ice and –ise: Some words have -ice ending for the noun and -ise ending for the verb in British English. However, in American English both noun and verb are spelled –ice.

practice(n.)- to practise (vb.) practice (n.) – to practice (vb.)

4. –ll and –l: In British English, when a word ends in a single consonant, it is doubled when we add a suffix beginning with a vowel

traveller skillful

traveler skilful

British English and American English have different spellings for certain words

cheque programme moustache

check program mustache

Writing dates In British English we follow the day – month – year format, although this is month – day – year format in American English.

2/7/2011 is July 2nd 2/7/2011 February 7th

GRAMMAR PRACTICE

4. Find the correct American English expressions: elevator, chips, baggage, notebook, garbage can, subway, railroad, vacation, movie, truck, automobile, candies, pants, cookies, airplane, cell phone, fall, student, cab, drugstore, gas station.

British English American English French fries

sweets

rubbish bin

mobile phone

pupil

car

exercise book

113

taxi

petrol station

autumn

luggage

biscuits

trousers

chemist’s

lift

underground train

holiday

film

railroad

aeroplane

lorry 5. Write the text in American English choosing the correct word:

Last month I drove to London. As there was an accident on the R32 I had to take a detour / diversion. I stopped in front of a theatre / theater to ask for directions. A young woman told me to turn right at the crossroad / intersection and ask again at the gas station / petrol station. There a friendly shop assistant / sales clerk told me to take the second exit of the round about / traffic circle. After I had passed a pedestrian crossing / zebra crossing I saw a bookshop / bookstore and a large car park / parking lot. I parked my car / automobile there and walked to the center / centre.

6. Write the text in British English choosing the correct word: Mr. Simpson was very busy yesterday. He drove to a drugstore / chemist’s for some

medicines. Then he went to the supermarket to get some biscuits / cookies and candies / sweets. He also needed some new trousers / pants and notebooks / exercise books for his little boy. He went back home and realised that he had lost his cell phone / mobile phone. Then Mr. Simpson had to return to all places he was before to find it. What a busy day!

7. Decide whether the sentence is written in British or American English: a. What about another chocolate biscuit? b. We’ll have to stop at the next gas station. c. I got this book at the new bookstore. d. He loves travelling by train. e. Put this box into the garbage can, please. f. Have you checked your DVD player already? g. Have you seen Sam’s new truck? h. The park is in the centre of the town. i. I like French fries, they're very crispy. j. Have you seen the latest movie?

114

k. I've passed this test. So I'll get my driving licence very soon. l. Tom told me to get off the Underground at Tower Hill.

WRITING FOCUS

8. a. Write an essay about the things you like most and the things you like least in your own culture. Make reference to what it means to be polite and what is considered rude in your culture.

b. Do you consider "when in Rome, do as the Romans do" is always good advice? Why or why not? Have you ever been in a situation where you felt you had to "do as the Romans do"? SPEAKING FOCUS

9. Debate on the following topics: a. Imagine you are at a party in England. How could you begin a conversation with a stranger? Continue the conversations with your partner. b. An American friend of yours is going to work in Japan. Give some advice about how he/she should and shouldn't behave. c. What other culture(s) besides your own do you admire? Why? d. If aliens visited your country, what might surprise them?

115

Unit 18Unit 18Unit 18Unit 18

TTHHEE LLIIFFEE OOFF AA SSUUPPEERRMMAARRKKEETT MMAANNAAGGEERR

Being a supermarket manager is not an easy task. A supermarket manager may

assume many different duties, such as supervising employees and store operations, taking inventory and ordering products, performing administrative and human resources work, or engaging in safety inspections and loss prevention. Most managers are very skilled at organizing merchandise, communicating with employees and providing excellent customer service.

A supermarket manager in a large store might be in charge of supervising a specific department. A manager typically monitors the inventory and the appearance of his department. He usually determines the price on items, directs employees in stocking shelves, and orders new products when quantities are low. A manager may design store displays and actively engage with customers to inform them of deals and help them find various products.

To become a supermarket manager, a person must typically have at least a high school diploma and extensive supervisory experience in retail or customer service. But most supermarket manager positions often require candidates to hold college degrees in business management or accounting.

*** Jonathan Matthews left school at seventeen, went to college and then worked in his

father’s mini-market. After two years, he went to work for Bargain Foods and then he joined Saver Mall as a trainee manager. Three years later he got his present job as a supermarket manager with Saver Mall. This is what he told us about his job:

“The supermarket that I manage is in West London, but I spend most of my time visiting Saver Mall supermarkets all over Britain. I need to see the way things are working in the other supermarkets. I also attend lots of meetings. My work hours change every week because Saver Mall is opened 24 hours a day. Last week I worked from 3 p.m. to 11 p.m. but this week I need to be at work from 7 a.m. to 3 p.m. The first thing I do every day is to check my emails.

Sometimes, I travel to different countries to check how foreign supermarkets are doing. That’s my favourite part of the job! But I like my work in London, too. Travelling can be very hard work. When I get back from a journey, I usually go straight home to get some sleep. I earn quite good money and I’m happy to be working for Saver Mall.” Vocabulary Focus

employee – someone who is paid regularly to work for a person or a company

to be in charge of – to be responsible of

employer – a person or a company that pays someone to work as a member of their staff

to stock – if a shop stocks goods, it has them for sale

loss – no longer having something, having less trainee – someone who is in training

116

than before, money lost, death of somebody, failure to win race etc.

for a particular profession or job

skilled – having the ability and experience to do something well

merchandise – goods that people buy and sell

Vocabulary Practice 1. Choose the correct answer:

1. Jonathan’s first job was a. at college. b. with Bargain Foods. c. in a mini-market

2. When Jonathan first worked for Saver Mall, he was a. an assistant. b. a manager. c. a trainee manager.

3. Jonathan does most of his work a. in London. b. in other countries. c. in other supermarkets.

4. Jonathan’s working hours a. are different each week. b. are 3 p.m. to 11 p.m. c. are 7 a.m. to 3 p.m.

5. At the beginning of each day, Jonathan a. goes to a meeting. b. checks other supermarkets. c. reads massages.

6. What does Jonathan like best? a. checking emails b. going to different countries c. travelling by road

7. The first thing Jonathan does after a journey is a. have a meal. b. go to his office. c. go to bed.

8. Jonathan a. enjoys his job. b. does not like his work in London. c. wants to earn more money.

2. Read the description and find the word. The first letter is already given. There is

one space for each other letter in the word:

a. You can go there to buy or sell goods. b. When someone sends you this kind of message, you read it on a computer. c. The person whose job is to organize and control the work of a business or organisation. d. It arrives by post and you must open an envelope to read it. e. A person or a company that sells goods directly to the public for their own use. f. Type of plastic money you can use in order to pay by. g. A shop or place where a particular product is sold. h. Goods that people buy or sell.

m _ _ _ _ _ e _ _ _ _ m _ _ _ _ _ _ l _ _ _ _ _ r _ _ _ _ _ _ _ c _ _ _ o _ _ _ _ _ m _ _ _ _ _ _ _ _ _ _

117

GRAMMAR FOCUS WISHES

We can use wish / if only to express a wish.

Past Tense Simple/Continuous to say that we would like something to be different about a present situation. Examples: I wish I were rich now.(but I’m not) If only I were going shopping. (but I’m not)

Past Perfect to express regret about something which happened or didn’t happen in the past. Examples: I wish I had finished setting up all the prices. If only she hadn’t told me to do that. (but she did)

Subject + would + short infinitive to express a polite imperative or a desire for a situation or person’s behaviour to change. Examples: I wish you would stop smoking. If only it would stop raining.

Note: If only is used in exactly the same way as wish, but it is more emphatic or more dramatic. UNREAL PAST – had better / would rather

The Past Tense Simple can be used to talk about imaginary, unreal or improbable situations in the present or in the present and the Past Perfect can be used to talk about imaginary, unreal or improbable situations in the past. This is called Unreal Past.

Past Tense Simple to refer to the unreal present: Examples: If I were you, I’d go shopping later.

I wish he were more patient with the customers. Suppose you were asked to work extra hours, what would you do? He behaves as if he were the boss. It’s time we left.

Past Perfect to refer to the unreal past: Examples: If I had been more careful, I wouldn’t have lost it. If only he hadn’t told something like that. I’d rather he hadn’t spent so much money yesterday. Suppose he had seen you, what would you have done? They looked at each other as if they had met before. had better = should

- for present or future reference: You’d better buy the cheaper one. - for past reference: It would have been better if you had told them the truth.

I would rather = I’d prefer

When the subject of would rather is also the subject of the following verb, we use I’d rather+ Present Infinitive (for present / future reference) or I’d rather+ Perfect Infinitive (for past reference). Examples: I’d rather leave now.

I’d rather have admitted going back to the supermarket. When the subject of would rather is different from the subject of the following verb, we use: I’d rather smb.+ Past Tense (for present or future reference) or I’d rather smb.+ Past Perfect (for past reference). Examples: I’d rather you applied for the manager position.

I’d rather you had called me earlier.

GRAMMAR PRACTICE

118

3. Rephrase the sentences below so as to use a past tense form after the verb wish: a. I am sorry you are not one of our customers. b. I regret the ATM is out of order. c. I am sorry Jonathan does not want to attend this meeting. d. I am sorry they do not sell any item. e. The manager regrets he is so busy today. f. It’ a pity you are late for work every morning. g. It’s a pity the manager is not in the office. h. It’s a pity they do not earn so much.

4. Put the verbs in brackets into the correct tense: a. If only I ........................ (know) about your problem, I would have helped you. b. If the supermarket manager ........................ (not/give) his approval, this wouldn’t

have happened. c. I’d rather we .................... (have) a stronger advertising campaign. d. I wish I .................. (call) my manager to apologise. e. If only I .................. (work) on week-ends. f. I wish I .................. (talk) to him like that.

5. Complete the sentences using the words in bold. Use two to five words: a. It would have been better if you had bought the two products. only If .......................................the two products. b. I didn’t go to the meeting because I didn’t know about it. known If ......................................the meeting, I would have gone. c. You ought to have finished the project by now. time It’s .......................................the project. d. I think you should join our team. Were If .........................., I would join our team. e. I didn’t make up my employment file, so I can’t apply for this job.

wish ............................

6. Translate into English using would rather or had better: a. Domnul director ar prefera ca tu să participi la această expoziŃie. b. Cred că mai degrabă aş bea o cafea în dimineaŃa aceasta. c. Aş prefera să vii la timp la întâlnirea de afaceri. d. Mai bine ai verifica preŃurile la noile produse. e. Mai degrabă ai fi spus asta de la bun început. f. Ştiu că ai prefera ca ei să fie aici acum. g. Directorul ar prefera ca noi să obŃinem cele mai bune preŃuri. h. Aş prefera să le spui de la început despre planurile noastre de afaceri. WRITING FOCUS

7. Make up a job advertisement for the position of a supermarket manager. SPEAKING FOCUS

8. Express your opinion on the following statement: “Don’t buy what you want, buy what you need?”

119

Unit 19Unit 19Unit 19Unit 19

BBEEAATTIINNGG TTHHEE CCOOMMPPEETTIITTIIOONN

There are some tips that you should consider for “beating a competition.” 1. Know what you want. Be clear about the information you are looking for. Much of

what you are seeking is already available. Talk to your staff, customers and suppliers. Prepare a list of the specific information you require. Look for the competitors’ price plans, additional services and staff capabilities.

2. Get to know your competitors. Make sure you balance older established businesses with ones new to the market. Talk to them at trade shows when they are more willing to be chatty. But be cautious: sharp competitors may offer you some misinformation or embellish sales figures to make themselves look good.

3. Make competitive links. If you have many competitors, put the information on a spreadsheet. Look for the common themes of successful and unsuccessful competitors. Overall, try to determine their individual strategies. Don’t be surprised if several share the same strategy.

4. Use the Internet. Use the Internet for a quick insight into a competitor’s business style. The information is freely available and easily accessible. As a starting point, find out whether your competitors have a website and review it thoroughly. Look for upcoming trends in your area of business.

5. Contact your competitors. Call or visit competitors and talk to their staff. Employees can be an important source of valuable information. You may need to make several calls or visits to develop a complete picture.

6. Alert your staff. Talk to your personnel about the importance of confidentiality. Train them to ask why callers might need the information they are seeking. Develop a company policy regarding the information that is allowed to be discussed with outsiders.

7. Allow time. Don’t expect to gather all the information you need to make sound business decisions in a few telephone calls or store visits. Take your time. Avoid the trap of using old information. You should be gathering information on an ongoing basis and routinely adjusting your marketing plan.

8. Read brochures. Competitive literature will tell you many things-including strategy, positioning, products and services, target group and key staff. Check to see if the literature is out of date or up to the minute.

9. Call the competitors. Examine how their staff answer the phone and how they approach prospective customers or opportunities. Make a call to them and act like a new business prospect. Have others do the same thing, and then compare notes.

10. It’s not all bad. Not everything the competitor does is right or wrong. Copy the good and avoid the bad.

120

Vocabulary Focus

available – able to be obtained, taken spreadsheet – a chart produced on a computer that shoes numbers in a way that makes them easy to compare

staff – the people who work for a particular company, organization or institution

insight – the ability to notice and understand a lot about people or situations

supplier- a company, organization or country that supplies or sells a product or service

thoroughly – very much, very carefully, so that nothing is missed

trade – the activity of buying or selling goods or services

upcoming – an event that will happen soon

to embellish – to make a story more interesting by adding details, especially ones that are not completely true

trend – a gradual change or development that produces a particular result

sale – the process of selling goods or services for money

to seek – to try to find something or someone that you need in your life, to look for

figure – number, amount to gather – to come together, to bring things together

Vocabulary Practice

1. Answer the following questions: a. What do you mean by competition? b. How important is it to make up a list of specific information? c. How do you like to keep yourself informed? Why? d. What should you know about your competitors? e. Do you generally use the Internet to find out specific information? f. Is it really important to call or visit your competitors? g. How important is to educate your staff about confidentiality?

2. Think of the word which best fits each gap. Write only one word in each gap: Most people dream ........ becoming reach and famous, but is that ........... success is

really about? It is a fact that many people ............ have achieved fame and wealth are far less happy with their lives. They worry constantly ................. their money and reputation. They are rarely satisfied ............ what they have. Singers may lose their popularity, athletes may get injured and can no .............. perform well, and wealthy businessmen may lose their money ................ making risky deals or bad decisions. The best way to be happy with ................. and with your life is to reconsider what happiness really is. We must realise that human values and qualities are ........... more important than material things. A job, no matter .............. humble, which is done with interest and care is worth as ............... as instant fame. Being close to your family and having friends you can trust and depend .......... also makes for a happy, successful life. These are the things that really count and give you the right to consider ............. a successful person.

121

GRAMMAR FOCUS

THE PASSIVE VOICE

The Passive Voice is formed with the appropriate tense of the verb “to be” and the Past Participle of the verb to be conjugated.

Present Tense Simple Active Voice: This bank grants such loans. Passive Voice: Such loans are granted by this bank.

Present Tense Continuous Active Voice: This bank is granting such loans. Passive Voice: Such loans are being granted by this bank.

Past Tense Simple Active Voice: This bank granted such loans. Passive Voice: Such loans were granted by this bank.

Past Tense Continuous Active Voice: This bank was granting such loans. Passive Voice: Such loans were being granted by this bank.

Present Perfect Tense Simple Active Voice: This bank has granted such loans. Passive Voice: Such loans have been granted by this bank.

Past Perfect Tense Simple Active Voice: They said that the bank had granted such loans. Passive Voice: They said that such loans had been granted by this bank.

Future Tense Simple Active Voice: This bank will grant such loans. Passive Voice: Such loans will be granted by this bank.

Future in the Past Active Voice: They said that the bank would grant such loans. Passive Voice: They said that such loans would be granted by this bank.

Modals Active Voice: This bank can grant such loans. Passive Voice: Such loans can be granted by this bank.

Notes: 1. The Passive Voice can be also formed with the verb “get” and the Past Participle of the

verb to be conjugated. Example: All our items got broken during the transportation.

2. A synonym of the verb “get” is the verb “become” which expresses a gradual changing. It is often accompanied by “more and more” and ”increasingly”.

Example: The production of this factory is becoming increasingly specialized.

122

GRAMMAR PRACTICE 3. Replace the infinitives in brackets with the correct tense in the passive voice:

a. He (to tell) ……. to get clear information about what he is looking for. b. The factory (to build) ……. recently. c. You (to give) ……. the opportunity to study a foreign language here. d. The letter (to sign) ……. by the manager. e. If you visit the exhibition, you (to impress) …….. by the variety of exhibits. f. You (to give) …….. the necessary information concerning this matter. g. Your staff must (to educate) ……… about confidentiality. h. Many important things (to tell) ………. in the competitive literature. i. The Internet (to use) ………. for a quick insight of many competitors.

4. Turn the following active sentences into passive ones:

a. They visited their competitors two days ago. b. Do you know that the manager is waiting for you? c. We received their offer yesterday. d. She will not make a decision until the next business meeting. e. Customers should send their complains to the managing director. f. They have changed the marketing strategies in order to get more customers. g. The competitors have not heard anything about this new branch. h. The manager made me responsible for the sales department. i. They asked me about the sales figures.

5. Complete the second sentence so that it has a similar, meaning to the first

sentence, using the word given. You may use between three and six words.

a. They have decided they will sign the contract this week. signed

It has been decided .......................................... this week.

b. The lectures gave the students an insight into modern management. given The .............................. modern management by the lectures.

c. The university issued a leaflet telling students how to apply. by .............................. the university telling students how to apply.

d. The company is setting the interviews in May. being The interviews ............................ in May.

e. Everybody should learn how to speak a second language. taught A second language ............................ everybody.

123

6. Choose the most suitable alternative:

1. English ...................by everybody here. a. is speaking b. is spoken c. has spoken.

2. We tried to open the door, but it ....................... a. was locked b. has been locked c. locked

3. The manager ........................to arrive by Friday. a. will be expected b. was expected c. has expected

4. I promise you that the matter....................................... a. is looked into b. will be looked into c. has looked into

5. We all .......................some questions at the interview next week. a. have been asked b. is being asked c. will be asked

6. Success ................................................ a. must work b. has to work for c. must be worked for

7. Translate into English using the passive voice: a. Am fost sfătuită să discut mai mult cu angajaŃii lor despre această problemă. b. O parte din acest proiect a fost întocmit de specialiştii noştri. c. Toate informaŃiile au fost obŃinute săptămâna aceasta. d. Vi se vor da multe detalii în legătură cu acest contract mâine. e. Scrisoarea de afaceri tocmai a fost redactată de către secretară. f. Li s-a cerut să termine lucrarea la timp. g. Toate detaliile referitoare la acest proiect sunt date pe Internet. h. Nu s-a menŃionat nimic în legătură cu situaŃia lor financiară. i. Nu pot fi acordate astfel de informaŃii de către angajaŃii firmei lor. j. Nu s-a încercat nimic pentru a se lua o decizie la timp. WRITING FOCUS

8. Write an email to a friend asking different information on the marketing strategies used in their company. SPEAKING FOCUS

9. Debate on the following topics: a. How can you get successful in a competition? b. Speak about the responsibility of being successful. c. Give examples of successful people who managed to reach their position by beating the competition.

124

Unit 20Unit 20Unit 20Unit 20

TTHHEE EENNVVIIRROONNMMEENNTT–– AA RREEAALL GGLLOOBBAALL IISSSSUUEE

Our natural environment is a treasure that we should always take care of. Nowadays

environment protection is a very important issue since there are so many problems affecting the environment: acid rains, global warming, destruction of the wild habitats, the decline of many species of plants and animals. We all know that these threats exist and that humans have caused them. Many of us are very worried about the future of our planet and unless we can find a way of solving these problems the environment will suffer even more. We risk destroying the environment forever and causing irreversible damage that will have a devastating effect.

Everybody knows that our planet is in trouble. Therefore, it is vital to learn how to protect the environment. Everyone has a role to play. Community initiatives on environment protection should be put into effect. All public sectors should work hand in hand to protect and also educate the public. Students should take initiative through their university activities too. Volunteers are also called upon to protect Mother Nature by doing everything they can to prevent further degradation.

Everyone can do something to help slow down and reverse some of the damage. We must always remember to be green. We must learn to live in a sustainable way and learn how to use our natural resources which include air, freshwater, forests, wildlife, farmland and seas without damaging them. As populations grow and lifestyles change, we must keep the world in a good condition so that the future generations will have the same natural resources that we have. Consequently, try to consider some suggestions on how to be a green person:

1. Use recycled paper to help save trees. 2. Try to avoid buying plastic. It's hard to recycle. One way to cut down on plastic is

to refuse to use bags offered by supermarkets and use long lasting shopping bags instead. 3. Take your old clothes to charity shops. Some are sold, others are returned to

textile mills for recycling. 4. Use public transportation in the city. If everyone uses their own cars, pollution and

traffic congestion will become a huge problem. Use a bicycle or walk for short trips. 5. Sort out your rubbish. Organic matter such as potato peelings, left over food, tea

leaves can be transferred straight to a compost heap in the garden and used as a natural fertiliser for the plants. You must also take the other items such as plastic bottles, juice cartons and cardboard to nearby recycling banks.

6. Don't waste electricity or heat. Electricity and heating are produced by burning coal, oil and gas and this action gives off carbon dioxide.

In conclusion, the basic steps in protecting the environment are: preventing pollution, recycling materials, looking after reserves of water and conserving energy.

Vocabulary Focus

125

treasure – something that you look after carefully because you think is valuable or important

acid rain – rain containing a high level of acid that can damage the environment. It is caused by pollution in the air

degradation – the process of changing into a worse condition

volunteer – someone who is not paid for the work that they do, someone who offers to do something without being forced

Vocabulary Practice

1. Fill in the correct word from the list below: - natural - captivity - released - species - protect - breed - confine - extinct

Human population expansion and the effects of hunting are threatening many …………… to such an extent that they are almost ………… . In order to …………… them, many animals are kept in ……………. in zoos and safari parks. The idea is that when animals are able to ………….. in safety, their numbers will increase enough so that some can be …………… into their ……………. habitats. Some extreme animal rights activists, however, believe that it is better to allow a species to become extinct than to …………. them to a prison-like zoo. 2. Choose the right word:

Tourism brings income and employment, but tourists (upset/disturb/annoy) the environment and need services and accommodation, food, transport and waste disposal which can (destroy/crash/wipe) the qualities of an area that attracted tourists in the first (post/spot/place). Activities such as driving and water sports can (cause/result/bring) problems, especially when too many people decide to do the same thing in the same place. Eco-tourism is about enjoying your holiday destination without (wounding/spoiling/hurting) it. The demand for eco-tourism is (developing/increasing/extending) and there are now many holiday companies that work with local people to (guard/protect/prevent) their environment. As an eco-tourist, you can help by booking your holiday with a responsible company and (presenting/displaying/showing) respect for local customs when you arrive. 3. Fill in the correct word derived from the words in brackets:

(Conserve) …… are very concerned about the ever growing number of (endanger) ……… species in the world. (Environment) ………. problems such as freak weather conditions, fire and acid rain are resulting in the (destroy) ……… of vast areas of woodland and forest. These areas are home to large numbers of animals and, as the land is vital to their (survive) ………., this is having (alarm) ………… effects.

(Ecology) ……….. advocate the use of ozone-friendly products and recycling to achieve a (reduce) ………… in environmental damage. Safari parks have also been established in an attempt to give (protect) ……….. to animals from big-game hunters. Numbers are slowly beginning to increase and will (hope) ………..continue to do so in the future. GRAMMAR FOCUS

PHRASAL VERBS

126

to abandon to - to give smth. completely to to accuse of - to say that someone is guilty to accustom to - to make smb. used to to advance to/towards - to come as far as to agree on/upon - to have the same opinion about to agree to - to accept to to agree with - to think or say the same to aim at/for - to plan or intent to answer for - to be responsible for to apologize for - to say sorry for smth. to apply for - to make a formal request to ask about - to enquire about to ask for - to request to ask in - to invite in to assort with - to match to be about to - to be going to to be after - to want to chase to be with - to support, to work for, to be in

company with to believe in - to have faith in to belong to - to be the property of/to be a

member of to call for - to demand to call in - to invite someone to call on - to visit formally to call off - to cancel to carry on - to continue to charge for - to ask a price for to come across - to find/meet by chance to consist of - to be made up of to deal with - to treat to decide on/upon - to make a decision on to drop into - to visit a place informally to feel about - to have an opinion about to gaze at - to look steadily at to get after - to chase

to get to - to arrive at to go for - to support, to like, to intend to become to introduce to - to make someone known to

someone else to keep on - to continue to laugh at - to be amused by someone to learn from - to come to know to learn about - to know about to listen to - to pay attention to to long for - to wish very much for smb. or smth. to look after - to take care of to look for - to search to look into - to investigate to match with - to assort with to occupy with - to busy oneself with to pay for - to pay a sum of money to obtain smth. to plead for - to represent someone in the court to plot against - to conspire against to point at - to show, to aim to provide with - to supply with to rescue from - to save from to result in - to have as a result to run after - to chase, to be keen to get to send for - to ask somebody to come to show around - to take on a tour to take for - to accept to think about/on - to have thoughts concerning to wait for - to stay in a place expecting to wave at/to - to move the hand as a greeting to wonder at - to marvel at

GRAMMAR FOCUS 4. Fill in the correct preposition:

a. Recycling will prevent further damage …… the environment. b. Consumers need to insist ….. products that don’t harm animals. c. We must protect even tiny insects ………. extinction. d. We should prevent hunters …………. killing animals. e. Climate change has been obvious……. scientists for many years. f. It is wrong to experiment …….. animals. g. We all need to protest ………. global warming.

127

5. Choose the right preposition:

1. Wait……..me to finish writing this report. a. at b. on c. for

2. I generally agree ……..you. a. on b. about c. with

3. He is really interested ……. global issues. a. about b. on c. in

4. Who looks ….. your pets when you are away? a. into b. after c. for

5. If you want to get ……. the zoo, you must go this way. a. at b. to c. about

6. I can’t come to work on Friday. Could you give me a day …….? a. out b. on c. off

7. The investigation has not been finished yet. They are still looking…..the matter. a. on b. into c. around

8. I’ll call ….. him after I finish classes. a. on b. around c. in

WRITING FOCUS

6. a. Find information and then write an article about the methods of saving energy at home. b. Write 10-15 lines about the importance of environment protection. SPEAKING FOCUS

7. Debate on the following topics: a. Comment on the following statement: “Cars should be banned from the city centre.” b. Why should natural resources be conserved? c. Do you think there are lessons to learn from nature? d. Which is more important, increasing people's standard of living, or protecting the environment? Think of a situation in your area involving this issue. e. Who do you think is more responsible for pollution, individual people or the government? Explain.

128

LLIISSTT OOFF IIRRRREEGGUULLAARR VVEERRBBSS

Infinitive Past Tense Past Participle Translation

abide abode abode a sta, a rămâne; a trăi, a locui

arise arose arisen a se ridica

awake awoke awoken a trezi, a (se) deştepta

be was been a fi

bore born a naşte bear bore borne a purta, a duce, a suporta

beat beat beaten abate

become became become a deveni

begin began begun a începe

behold beheld beheld a zări, a vedea, a privi

bend bent bent a îndoi

bet bet bet a pune prinsoare

bind bound bound alega

bite bit bitten a muşca

bleed bled bled a sângera

blow blew blown a sufla

break broke broken a sparge

bring brought brought a aduce

broadcast broadcast, -ed broadcast,-ed a transmite

build built built a clădi

burn burnt burnt a arde

burst burst burst a face explozie, a exploda, a izbucni

buy bought bought a cumpăra

cast cast cast a arunca, a azvârli

catch caught caught a prinde

choose chose chosen a alege

clothe clothed sau clad clothed sau clad a (se) îmbrăca

come came come a veni

cost cost cost a costa

cut cut cut a tăia

129

Infinitive Past Tense Past Participle Translation

deal dealt dealt a se ocupa, a trata

dig dug dug a săpa

do did done a face

draw drew drawn a trage; a desena

dream dreamt dreamt a visa

drink drank drank a bea

drive drove driven a goni; a conduce (un vehicul)

eat ate eaten a mânca

fall fell fallen a cădea

feed fed fed a (se) hrăni, a da de mâncare

feel felt felt a simŃi

fight fought fought a lupta

find found found a găsi

fly flew flown a zbura

forbid forbade forbidden a interzice

forget forgot forgotten a uita

forgive forgave forgiven a ierta

forsake forsook forsaken a lăsa, a părăsi

freeze froze frozen a îngheŃa; a degera

get got got a obŃine

give gave given a da

go went gone a merge

grind ground ground a (se) macină; a (se) ascuŃi

grow grew grown a creşte

hang hung hung a agăŃa, a atârna

have had had a avea

hear heard heard a auzi

hide hid hidden a ascunde

hit hit hit a lovi; a atinge, a nimeri

hold held held a Ńine, a reŃine, a cuprinde

hurt hurt hurt a vătăma, a pricinui durere; a păgubi; a jigni, a ofensa,

130

Infinitive Past Tense Past Participle Translation

keep kept kept a face rău, a strica, a Ńine, a păstra; a observa, a respecta

knit knit,-ed knit sau knitted a împleti, a tricota, a croşeta

know knew known

lay laid laid

a şti, a cunoaşte

lead led led a pune, a aşeza

lean leant leant a îndruma, a conduce a (se) rezema

learn learnt learnt a învăŃa, a afla

learned learned

leave left left a lăsa, a părăsi; a pleca

let let let a permite

lie lay lain a fi culcat, a fi întins; a zăcea

light lit lit a (se) aprinde

lighted lighted

lose lost lost a pierde

make made made a face

mean meant meant a însemna

meet met met a întâlni

mistake mistook mistaken a înŃelege greşit; a confunda

mow mowed mown a cosi, a secera

pay paid paid a plăti

put put put a pune

read read read a citi

ride rode ridden a călări

ring rang rung a suna

rise rose risen a se ridica, a se scula (în picioare), a se înălŃa

run ran run a alerga

saw sawed sawn a tăia cu ferăstrăul

say said said a spune, a zice

131

Infinitive Past Tense Past Participle Translation

see saw seen a vedea

seek sought sought a căuta

sell sold sold a vinde

send sent sent a trimite

set set set a aşeza, apune; a regla, a fixa

sew sewed sewn sewed

a coase

shake shook shaken a clătina, a scutura

shave shaved shaven a se bărbieri

shine' shone shone a străluci, a sclipi

shoot shot shot a trage; a Ńinti; a împuşca

show showed shown a arăta

shrink shrank shrunk a (se) strâmta

a se strânge

shut shut shut a închide

sing sang sung a cânta

sit sat sat a se aşeza, a lua loc, a sta jos

sleep slept slept a dormi

slide slid slid a aluneca

smell smelt smelt a mirosi, a avea miros

sow sowed sown a semăna

speak spoke spoken a vorbi

spell spelt spelt a silabisi

spend spent spent a cheltui

spill spilt spilt a (se) vărsa

spin span spun a fila, a toarce

split split split a despica, a crăpa

spoil spoilt spoilt a prăda, a jefui, a despuia, a păgubi, a ruina, a strica

spread spread spread a întinde; a împrăştia

spring sprang sprung a sări

stand stood stood a sta în picioare

132

Infinitive Past Tense Past Participle Translation

steal stole stolen a fura

stick stuck stuck a înfige; a lipi

strike struck struck a izbi; a ciocăni; a lovi; a bate

swear swore sworn a jura

sweep swept swept a mătura

swell swelled swollen a umfla

swim swam swum a înota

take took taken a lua

teach taught taught a preda, a învăŃa pe cineva

tear tore tom a rupe, a sfâşia

tell told told a spune a povesti

think thought thought a gândi

throw threw thrown a arunca

understand understood understood a înŃelege

undo undid undone a anula, a desfiinŃa

undertake undertook undertaken a lua asupra sa

upset upset upset a răsturna, a dezorganiza

wake woke waked

woken waked

a se deştepta

wear wore worn a purta

weave wove woven a Ńese

weep wept wept a plânge

133

SSeelleecctteedd bbiibblliiooggrraapphhyy

Books:

• Bourke K., English Verbs and Tenses, Oxford University Press, 2003 • Camelia Chirilă, Veronica Melca, Essential English, Editura IndependenŃa Economică,

Piteşti, 2006 • Dictionary of English Language and Culture, Addison Wesley Longman Limited, Harlow,

2000 • English for Business & Administration, coordinated by the British Council, Cavallioti

Publishing House, Bucharest, 2000 • Evans V., Dooley J., Upstream Intermediate B2, Student’s Book, Express Publishing,

2002 • Graham Workman, Making Headway. Phrasal Verbs and Idioms. Advanced. Oxford

University Press. 1995. • Ian MacKenzie, English for Business Studies, Cambridge University Press, 2001 • Leon LeviŃchi, Gramatica Limbii Engleze, Editura Teora, Bucureşti, 2001 • Mann, R., Bell, J., Gower, R., First Certificate Expert, Student’s Resource Book,

Logman, 2003 • Marcheteau, M., Berman, J.P., Engleza pentru economie, Business &

Economics, Teora, Bucuresti, 2000 • Macmillan English Dictionary for Advanced Learners, Macmillan, London, 2002 • McCarthy, Michael and Felicity O’Dell. English Vocabulary in Use – Upper Intermediate.,

Cambridge University Press, London, 2004 • Michel Marcheteau, Jean-Pierre Berman, Engleza comercială în 40 de lecŃii, Editura

Niculescu, Bucureşti, 2002 • Paul Emmerson, Business Grammar Builder, Macmillan, London, 2002 • Serena Murdoch-Stern, Limba engleză pentru afaceri, Editura Polirom, Bucureşti, 2008 • Simon Sweeney, English for Business Communication, Cambridge University Press,

2000 • Vianu Lidia, English with a key, Editura Teora, Bucureşti, 2001 • *** English phrasal Verbs in Use – 70 units of vocabulary reference and practice. Self- 2nd edition, Cambridge University Press, London, 2001. Excerpt. 76-77

Internet Resources: • A World Guide of Good Manners

<http://www.elanguages.org/files/21577 - Marea Britanie> • Bezon, Felipe. Different Types of Entertainment. 2 October 2009. Web. 6 August 2011

<http://ezinearticles.com/?Different-Types-of-Entertainment> • Dictionary, Encyclopaedia and Thesaurus - The Free Dictionary. Web. July 2011 <http://www.thefreedictionary.com>

134

• Dictionary and Thesaurus - Merriam-Webster Online. Web. July 2011 <http://www.merriam-webster.com/dictionary>

• Education in England.15 august 2011. Web. August 2011. <http://en.wikipedia.org/wiki/Education_in_England>.

• Expressions for Agreeing and Disagreeing in English – English Club. 1997-2011. Web. 27 July 2011. <http://www.englishclub.com/speaking/agreeing-disagreeing-expressions.htm>.

• English Used When Describing People - Yada Yada English. Web. July 2011.

• <http://www.yadayadaenglish.com/describepeople.htm>.

• Formal and Informal Language. Study Skills Brochure SLC/11/2006. Web. July 2011. • <http://www.flinders.edu.au/SLC> .

• Higher education in the United States. 15 August 2011. Web. August 2011. • <http://en.wikipedia.org/wiki/Higher_education_in_the_United_States>.

• Main Differences between Formal and Informal English. 13 May 2010. Web. July 2011. • <http://www.englishlci.com/blog/main-differences-between-formal-and-informal-english/>.

• Pronouns – English Club. 1997-2011. Web. 27 July 2011. • <http://www.englishclub.com/grammar/pronouns.htm>.

• Past Progressive (Past Continuous), short explanation and exercises • www.ego4u.com/en/cram-up/grammar/past-progressive

• Romanian educational system. 28 June 2011. Web. August 2011. • <http://en.wikipedia.org/wiki/Romanian_educational_system>.

• Travelling in Europe- Documents you will need • www.europa.eu › EUROPA › Travelling in Europe

• Types of business communication • <http://www.ehow.com/types-business-communication-methods.html>

• Quotations on communication • <http://thinkexist.com/quotations/communication>